ID: 949034851

View in Genome Browser
Species Human (GRCh38)
Location 2:241811674-241811696
Sequence TCCCATTGGGAGATGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949034851_949034867 24 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034867 2:241811721-241811743 TGTGACACTGAGGGTTCCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 196
949034851_949034866 23 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034866 2:241811720-241811742 GTGTGACACTGAGGGTTCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 150
949034851_949034868 25 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034868 2:241811722-241811744 GTGACACTGAGGGTTCCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 246
949034851_949034863 14 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034863 2:241811711-241811733 ACAGGGTGGGTGTGACACTGAGG 0: 1
1: 0
2: 3
3: 28
4: 222
949034851_949034865 22 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034865 2:241811719-241811741 GGTGTGACACTGAGGGTTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 175
949034851_949034864 15 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034864 2:241811712-241811734 CAGGGTGGGTGTGACACTGAGGG 0: 1
1: 0
2: 1
3: 22
4: 308
949034851_949034859 1 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034859 2:241811698-241811720 ACTTACCTGGCCCACAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
949034851_949034858 0 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034858 2:241811697-241811719 CACTTACCTGGCCCACAGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 176
949034851_949034856 -4 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034856 2:241811693-241811715 GGGACACTTACCTGGCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 138
949034851_949034857 -3 Left 949034851 2:241811674-241811696 CCCACATGCATCTCCCAATGGGA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 949034857 2:241811694-241811716 GGACACTTACCTGGCCCACAGGG 0: 1
1: 0
2: 0
3: 42
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949034851 Original CRISPR TCCCATTGGGAGATGCATGT GGG (reversed) Intronic
900533202 1:3164859-3164881 GCTCCTTGGGAGATGCAGGTGGG + Intronic
900877994 1:5359455-5359477 TCCCAGTGGGAGGTTCATGAGGG + Intergenic
901816395 1:11795955-11795977 TCCCTTTTGGTGATGCTTGTTGG + Intronic
902764516 1:18605603-18605625 TCCCATTGGGAAAGGCAGGTGGG - Intergenic
908292799 1:62685711-62685733 TGAGATTGGGAGATGCAAGTGGG - Intronic
910663953 1:89704335-89704357 TCCCATGATGACATGCATGTAGG - Intronic
916572984 1:166043131-166043153 TCTGATTGGCTGATGCATGTCGG - Intergenic
917371989 1:174302864-174302886 TCCTATTTGAAGATGCATGTTGG + Intronic
921639731 1:217538525-217538547 TCCCATTTGCAGATACATGAAGG + Intronic
923317771 1:232797779-232797801 TCCAATTGGAACATGCATTTGGG - Intergenic
1064332338 10:14405680-14405702 TATCATTGGGAGATGGAAGTGGG - Intronic
1067485169 10:46642080-46642102 GCCCTTTGGGAGATGAAAGTGGG - Intergenic
1067609589 10:47699578-47699600 GCCCTTTGGGAGATGAAAGTGGG + Intergenic
1068904680 10:62309758-62309780 TCCCACTGGGAGCTACCTGTGGG - Intergenic
1069143751 10:64862582-64862604 GCACATTGAGAGATACATGTAGG + Intergenic
1070693248 10:78543147-78543169 TGACATTGGGAGATGTATCTGGG + Intergenic
1071625178 10:87161203-87161225 GCCCTTTGGGAGATGAAAGTGGG + Intronic
1077468157 11:2743514-2743536 TCCCTCTGGGAGCTGCATGCCGG - Intronic
1077484605 11:2832983-2833005 TCCCAGTGGGAGACAGATGTGGG + Intronic
1077945744 11:6896067-6896089 TACATTTGGGCGATGCATGTTGG - Intergenic
1079368739 11:19832054-19832076 GCCCATTAAGAGATGCCTGTTGG + Intronic
1080977058 11:37356304-37356326 TCTCATTGGGAGGTGCATACAGG - Intergenic
1083376022 11:62222062-62222084 TGACATTGGGAGATGGAAGTTGG - Intergenic
1086666282 11:89487659-89487681 TCCCACTGGTATACGCATGTGGG - Intronic
1089681308 11:120120455-120120477 CCCCAGTGTGAGATGAATGTGGG - Intronic
1090282399 11:125467408-125467430 TCCCATAGGGAGATGCACTAGGG + Intronic
1091054367 11:132404519-132404541 TCCTATTGGGTGATCCATGATGG + Intergenic
1091132619 11:133159213-133159235 TCCCATTCAGAAATGCTTGTCGG - Intronic
1093215903 12:16361005-16361027 TCCCATTCCTATATGCATGTGGG - Intronic
1096277914 12:50226503-50226525 TCCCATTTTGAGATGCAAGAAGG + Intronic
1098387638 12:69935689-69935711 TCGCATTGGGAGATGGAAGGCGG - Intronic
1102436638 12:112929325-112929347 TCCCTTTGGGAGATGGATGGGGG - Intronic
1104209765 12:126677549-126677571 GCCCAGTGGGAGGTGCACGTTGG + Intergenic
1107199688 13:37699047-37699069 TCCCATTGGGATTTGAATCTTGG + Intronic
1108765723 13:53626961-53626983 TCCCATTCAGAGATGCAACTCGG + Intergenic
1109882582 13:68499685-68499707 TCAGGTTGGGAGAAGCATGTAGG + Intergenic
1111262859 13:85765462-85765484 TCTCATTGTGAGATGGATGGAGG - Intergenic
1112194189 13:97208592-97208614 TCTCAGTGGTAGATGCATGTGGG + Intergenic
1113400696 13:109990043-109990065 TTCTACTGGGAGATGCATTTAGG - Intergenic
1114694462 14:24613410-24613432 TCTAAGTGGGAGTTGCATGTGGG + Intergenic
1115316343 14:32028751-32028773 TGCCAGTGGGATATGCATTTTGG + Intergenic
1115468143 14:33738574-33738596 TCACATTAGCAGATGCAGGTTGG - Intronic
1118464717 14:66020537-66020559 TCCCAGTGGGTGTAGCATGTAGG - Intergenic
1119236669 14:73025894-73025916 CCCAATTGTGGGATGCATGTGGG - Intronic
1120088906 14:80308450-80308472 TCCCTTTGGGATCAGCATGTAGG - Intronic
1120648233 14:87098915-87098937 TCCCATTGAGGAATGCATATGGG - Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121525459 14:94616200-94616222 TCCCATTGTTAGAGGCAGGTGGG - Intronic
1124219957 15:27842897-27842919 CTCCAGTGGGTGATGCATGTGGG - Intronic
1124972078 15:34496949-34496971 ACCCAGAGTGAGATGCATGTCGG - Intergenic
1128527240 15:68420971-68420993 CCTCAATGGGAGAAGCATGTTGG + Intronic
1129354171 15:74978072-74978094 TTCTATTGGGAGATGCTTGAAGG + Intronic
1129895757 15:79104758-79104780 TCCCAAAGGGAGAGCCATGTTGG + Intergenic
1131718614 15:95142182-95142204 TCCCACTGTGATATGTATGTAGG - Intergenic
1131932236 15:97455723-97455745 TCCTATTGGGAGGAGCATATTGG + Intergenic
1135675221 16:24409307-24409329 ACCCAATGTGAGATGCATCTTGG - Intergenic
1136056060 16:27690572-27690594 GCCCATTTGGAAATGCATGGAGG + Intronic
1138268496 16:55677905-55677927 TCACTTTGGGAGATGGAGGTGGG - Intronic
1138603419 16:58071493-58071515 TCCCAGTAGGAGATGCAGTTTGG - Intergenic
1140380767 16:74485023-74485045 TCCCCTTGGGAGGTTGATGTGGG - Intronic
1143300381 17:5905422-5905444 GCACTTTGGGAGATGGATGTGGG + Intronic
1145355809 17:22148636-22148658 TCCAATGGGGAGATACATATGGG - Intergenic
1150638077 17:66930557-66930579 GCACATTGGGAGGTGCAGGTGGG + Intergenic
1152437800 17:80286820-80286842 GCCCCCTGGGAGATGCCTGTGGG + Intronic
1153687643 18:7562520-7562542 TCCCACTTTTAGATGCATGTTGG - Intergenic
1153789310 18:8563368-8563390 TCCCAGCAGGAGATGAATGTAGG + Intergenic
1155569509 18:27176303-27176325 TCCCATTGGAGGATGAATTTGGG + Intronic
1157307074 18:46525166-46525188 TCCTTTTGGGAGAAGCCTGTGGG + Intronic
1158534942 18:58299706-58299728 TCCCTTTGGGAGATGAATTGGGG + Intronic
1159506691 18:69347320-69347342 TCCCAAGGTGAGCTGCATGTAGG + Intergenic
1159885165 18:73896695-73896717 TCCCATTAGGAGAGGCATTTGGG + Intergenic
1160063447 18:75552368-75552390 TCAGGTTGGGACATGCATGTTGG - Intergenic
1160551057 18:79694075-79694097 TCCCATTGACAGATGCAGCTTGG + Intronic
1163798522 19:19350952-19350974 TCCCTTTGGGAGGTGGATGGGGG + Intronic
1164511762 19:28903291-28903313 TCCCATTGGTACATGCCTGCTGG + Intergenic
1164987174 19:32657079-32657101 TCTCTTTGGGAGATGGAGGTGGG + Intronic
925720537 2:6822350-6822372 GCCAGTTTGGAGATGCATGTAGG - Intergenic
928283409 2:29968242-29968264 TCACACTGTGAGAGGCATGTGGG - Intergenic
928347896 2:30517676-30517698 TCCCTTTGGTAGATGGATTTTGG - Intronic
930568732 2:53057208-53057230 TACCATTTGGAGATACAAGTGGG + Intergenic
932534483 2:72578381-72578403 TCCAATTGGAAGATTCATCTTGG - Intronic
934590230 2:95543040-95543062 TACTATTGGGAGGTTCATGTGGG - Intergenic
935965353 2:108467541-108467563 ACACTTTGGGAGATGCAAGTGGG - Intronic
936642101 2:114325044-114325066 TAACATTGGAAGATGCATGAAGG - Intergenic
936710950 2:115130669-115130691 TCACATTCAGAGAGGCATGTGGG - Intronic
936899960 2:117471261-117471283 TCCAAGTGGGAGCTGCAAGTTGG + Intergenic
939886719 2:147689326-147689348 CACCATTTGGAGATGCATGAGGG + Intergenic
939950808 2:148469826-148469848 ACCTGTTGGGAGAAGCATGTTGG - Exonic
941875963 2:170433569-170433591 TCAAAGTGGGAGATGCATGAAGG + Intronic
944739367 2:202596708-202596730 TCTCAGAGAGAGATGCATGTTGG - Intergenic
945494115 2:210489385-210489407 TCACATAGGTAGATGCATGCTGG + Intronic
949034851 2:241811674-241811696 TCCCATTGGGAGATGCATGTGGG - Intronic
1169231711 20:3893884-3893906 GCCCATTGGGAGAGGCAAGATGG + Intronic
1175126248 20:56754033-56754055 TCCTACTGGGAGATGCATGCTGG - Intergenic
1175668410 20:60880026-60880048 TCCCATGGAGAAATGGATGTGGG - Intergenic
1178000828 21:28160500-28160522 CCCTATTGAGAGATCCATGTGGG + Intergenic
1179456188 21:41502045-41502067 TGCCATTGTGAGATTCAAGTGGG - Intronic
951461001 3:22951995-22952017 TTCCAGTGGGAGCTGCCTGTTGG + Intergenic
953003706 3:38958171-38958193 TCCCATGGGGGGCTACATGTGGG - Intergenic
954524459 3:51257502-51257524 TCACAATGTGAGAGGCATGTAGG + Intronic
955020853 3:55119770-55119792 TGCCCTTGGGAGATGGATCTGGG - Intergenic
955989152 3:64606712-64606734 TCCTATTGGATGATGAATGTTGG - Intronic
956602868 3:71041359-71041381 GTCCATTGGTAGAGGCATGTGGG + Exonic
961199415 3:125032480-125032502 TCCCATTTCTAGCTGCATGTGGG - Intronic
961768245 3:129228954-129228976 AGCCGCTGGGAGATGCATGTGGG + Intergenic
966693240 3:182762703-182762725 TCCCCATGGGAGAAGCCTGTAGG - Intergenic
967834421 3:193948858-193948880 TCCAGGTGGGAGAAGCATGTTGG - Intergenic
968925261 4:3543657-3543679 TCCTAGTGGGAGTTTCATGTCGG - Intergenic
973190637 4:47381407-47381429 TCCCATTGGAAGATGCAGCATGG - Intronic
977179500 4:93856910-93856932 TCCCATTGGGAGGAGAAGGTAGG + Intergenic
978719123 4:111885502-111885524 TCCCATTGTAATATGCATTTAGG - Intergenic
979102481 4:116637869-116637891 TCCCATTTGTAGATGAGTGTGGG + Intergenic
982266302 4:153541548-153541570 TTCCATTGGGAGGTGCCTGTGGG + Intronic
984550602 4:181154467-181154489 TCCAATTGGAAGATGCCAGTGGG + Intergenic
985014934 4:185623876-185623898 TCGAATTCGGAGATGCGTGTGGG + Exonic
985906677 5:2843141-2843163 TCCCATTGGTAGACGAAAGTGGG + Intergenic
986645773 5:9914611-9914633 TCACATGGAGAGATGCACGTGGG + Intergenic
987901548 5:24018469-24018491 TCCCATTATGAGATGCATTATGG - Intronic
988021362 5:25626699-25626721 TCTCATTGGGAGCTGCAGATTGG - Intergenic
988141571 5:27249142-27249164 TGCCATTTGGAGATAAATGTAGG - Intergenic
991142732 5:63263809-63263831 TCCCATTTGGAATTGCATTTTGG + Intergenic
991636348 5:68709882-68709904 TCCCATGGGGGGATGCATGGAGG - Intergenic
991797567 5:70321433-70321455 TCTCTTTGGGAGCTGCATGCCGG + Intergenic
991831027 5:70688659-70688681 TCTCTTTGGGAGCTGCATGCCGG - Intergenic
991889909 5:71320754-71320776 TCTCTTTGGGAGCTGCATGCCGG + Intergenic
995375781 5:111472746-111472768 TGGCATTGAGAGATGCATGTAGG - Intronic
1003945759 6:11074017-11074039 TCTTATTGGAAGATGAATGTGGG + Intergenic
1020139933 7:5606525-5606547 ACCCAGAGTGAGATGCATGTTGG - Exonic
1022409893 7:30131426-30131448 TGCCTTTGGGAGATGTGTGTTGG - Intergenic
1024051190 7:45624388-45624410 TCCCTTTGGAAGATCCCTGTGGG + Intronic
1026689558 7:72540132-72540154 TGACATTGGGAGATCCCTGTGGG + Intergenic
1031349731 7:120715817-120715839 TCACATGGGAAGCTGCATGTTGG - Intronic
1038786158 8:30618412-30618434 TCCAATCGTGACATGCATGTAGG + Intronic
1040909502 8:52503417-52503439 TCCTGTTAGGAGATGCATGAGGG - Intergenic
1042047816 8:64673554-64673576 TCCCATTGTAAGTTGGATGTGGG + Intronic
1050058226 9:1677994-1678016 ACACATTGTGAGATGCAAGTGGG - Intergenic
1052693993 9:31853528-31853550 TCTCATTGGGAGAGCCATCTTGG - Intergenic
1056222217 9:84461501-84461523 TGACATTGGGAGAGGTATGTAGG + Intergenic
1057713262 9:97466326-97466348 TCCCATTTGCAGAGGCATTTAGG + Intronic
1060163014 9:121384039-121384061 TCACATTGGGAGATATATCTGGG + Intergenic
1189590212 X:42502952-42502974 TCCCATATGCACATGCATGTTGG - Intergenic
1192510834 X:71719550-71719572 TCCCAGTGGGAGAGGCGTGCTGG + Intergenic
1192515863 X:71762003-71762025 TCCCAGTGGGAGAGGCGTGCTGG - Intergenic
1194505093 X:94724264-94724286 TCCAAGTGGGAGCTGCAAGTTGG + Intergenic
1197930534 X:131690463-131690485 TCCCCTTGGCAGATGAATGGAGG + Intergenic
1200852146 Y:7894249-7894271 TCCCATGGAGAGATGTATGGTGG + Intergenic