ID: 949035589

View in Genome Browser
Species Human (GRCh38)
Location 2:241814493-241814515
Sequence CTGTCCGTGAAGGGGTACGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949035589_949035594 -9 Left 949035589 2:241814493-241814515 CCCTCGTACCCCTTCACGGACAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949035594 2:241814507-241814529 CACGGACAGTGCTCTTCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 24
949035589_949035595 -8 Left 949035589 2:241814493-241814515 CCCTCGTACCCCTTCACGGACAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949035595 2:241814508-241814530 ACGGACAGTGCTCTTCGAGCGGG 0: 1
1: 0
2: 0
3: 1
4: 28
949035589_949035597 1 Left 949035589 2:241814493-241814515 CCCTCGTACCCCTTCACGGACAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949035597 2:241814517-241814539 GCTCTTCGAGCGGGAGAGGACGG 0: 1
1: 0
2: 1
3: 6
4: 127
949035589_949035596 -3 Left 949035589 2:241814493-241814515 CCCTCGTACCCCTTCACGGACAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949035596 2:241814513-241814535 CAGTGCTCTTCGAGCGGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
949035589_949035598 2 Left 949035589 2:241814493-241814515 CCCTCGTACCCCTTCACGGACAG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 949035598 2:241814518-241814540 CTCTTCGAGCGGGAGAGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949035589 Original CRISPR CTGTCCGTGAAGGGGTACGA GGG (reversed) Exonic
900189834 1:1348696-1348718 CTGTCCGTGGAGCGGGGCGATGG - Intronic
902093398 1:13922588-13922610 CTGTCCCTGAATGGGAAGGATGG + Intergenic
905319427 1:37105457-37105479 CTGTCCTTGAGGAGGTTCGAGGG + Intergenic
1065839839 10:29693385-29693407 GTGCCTGTGAAGGGGTAGGAGGG - Intronic
1078344154 11:10529207-10529229 CTGTCAGTGTAGGTGTATGAAGG + Intronic
1080017265 11:27520801-27520823 CTGTCAGTGTTGGGGGACGAGGG - Intergenic
1083743900 11:64724718-64724740 CAGCCTGTGAAGGGGTAAGAGGG + Intergenic
1084708130 11:70827861-70827883 CTTTCCCTGAAGGCGTACCAGGG + Intronic
1085739720 11:79068628-79068650 CTGTCTGTGAAGGGGGAGAAGGG + Intronic
1104163751 12:126206050-126206072 CTGTGAGAGAAGGGGTATGATGG + Intergenic
1106699198 13:32210986-32211008 CTGGCCGTGAAGCGGTAGAAGGG - Exonic
1108502915 13:51084508-51084530 CTGGCCTTGAAGGGGAAGGACGG + Intergenic
1123024830 14:105419720-105419742 CTGTCCGGGAAGGGGCGCGCGGG + Intronic
1134666586 16:16023442-16023464 CTGATCATGAAGGGGCACGAGGG - Intronic
1138661924 16:58525434-58525456 CTTTCCATGAAGGTGTAAGAAGG - Intronic
1146017854 17:29248164-29248186 GAGACCGTGAAGGGTTACGAGGG + Intronic
1148350388 17:46937569-46937591 CTGACTGGGAAGGGGTACGAGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1153313952 18:3703910-3703932 CTGCCTGTGAAGGGGAACGTGGG - Intronic
1153834402 18:8951134-8951156 CTGTCCCTGAAGGGGCAGAAGGG - Intergenic
1160840273 19:1143651-1143673 CTGGCCGTGAAGGGGGAAGAAGG - Intronic
1161124347 19:2547412-2547434 GTGTCTGTGAAGGGGGAGGAAGG - Intronic
1162050701 19:8030846-8030868 CTGGCCGTGAAGGTGGAGGAAGG + Intronic
949035589 2:241814493-241814515 CTGTCCGTGAAGGGGTACGAGGG - Exonic
1175809275 20:61849046-61849068 CAGTCCCTGAAGGGGTGAGAAGG - Intronic
1176343693 21:5721390-5721412 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1176501134 21:7603066-7603088 CTGTCCTTGGAGGGGTATGCAGG + Intergenic
1176538014 21:8119459-8119481 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1181963019 22:26636745-26636767 CTGTCCAGGAAGGGGTTCCATGG + Intergenic
1182281627 22:29220725-29220747 CTGTCCTTGCAGTGGGACGAGGG - Intronic
1185343225 22:50300664-50300686 CTGGCGGGGAAGGGGTGCGACGG - Intronic
1203242961 22_KI270733v1_random:35814-35836 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
976261310 4:83147601-83147623 GTGTCTGTGAAAGGGTACCAAGG + Intergenic
982223508 4:153144747-153144769 CTGGCTGTAAAGGGGTACAAGGG - Intergenic
984803834 4:183736066-183736088 CTGTCCGGGAAGGGGGAGGGGGG - Intergenic
985488085 5:163043-163065 CTGTCCGTGCTGGGGAATGAGGG - Exonic
986648463 5:9941153-9941175 CTGTGTGTGGAGGGGTACCAGGG - Intergenic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
1001200909 5:169715766-169715788 CTGGCTGAGAAGGGGTATGAGGG - Intronic
1022488532 7:30799154-30799176 CTGTAAATGAAGGGGTAGGATGG + Intronic
1035685203 8:1519082-1519104 CAGTCCAGGAAGGGATACGAAGG + Intronic
1035716020 8:1755498-1755520 CTGTCTCTGAAGGGGTAGAACGG - Intergenic
1037689846 8:21172524-21172546 CTGTCCGGGAATGGGGACTAAGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1047757598 8:127930698-127930720 ATGTCAGTGAGGGGGTACGAAGG - Intergenic
1055969972 9:81902044-81902066 CTGTCCATGAAGGGCTAATACGG - Intergenic
1057269980 9:93645216-93645238 CTAGCCGAGAAGGGGTACAAGGG + Intronic
1060389622 9:123267690-123267712 ACGCCCGTGAAGGGGAACGATGG - Intronic
1061617985 9:131792708-131792730 CTTTCCCTCAAGGGGTTCGAGGG - Intergenic
1061799396 9:133105752-133105774 GTGTGCGTGAAGGGGGAAGAGGG - Intronic
1062354390 9:136154760-136154782 CCGTCCGTGAGGGGGTCCGGAGG + Intergenic
1203459287 Un_GL000220v1:18897-18919 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1193664448 X:84299125-84299147 GTGTCCGTGAAGGGGTGGGAGGG - Intergenic