ID: 949035692

View in Genome Browser
Species Human (GRCh38)
Location 2:241814844-241814866
Sequence ACCAGGACGTCCAGGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949035692_949035700 5 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035700 2:241814872-241814894 GAACTTCCTCCTCTGGGCAGTGG 0: 1
1: 1
2: 2
3: 31
4: 328
949035692_949035698 -2 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035698 2:241814865-241814887 GTCAGCGGAACTTCCTCCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
949035692_949035701 6 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035701 2:241814873-241814895 AACTTCCTCCTCTGGGCAGTGGG 0: 1
1: 0
2: 1
3: 37
4: 361
949035692_949035707 26 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035707 2:241814893-241814915 GGGGTGCCCTGCACGTGCTGGGG 0: 1
1: 0
2: 2
3: 16
4: 198
949035692_949035706 25 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035706 2:241814892-241814914 TGGGGTGCCCTGCACGTGCTGGG 0: 1
1: 0
2: 2
3: 11
4: 121
949035692_949035702 7 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035702 2:241814874-241814896 ACTTCCTCCTCTGGGCAGTGGGG 0: 1
1: 0
2: 4
3: 44
4: 539
949035692_949035699 -1 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035699 2:241814866-241814888 TCAGCGGAACTTCCTCCTCTGGG 0: 1
1: 0
2: 1
3: 51
4: 1248
949035692_949035705 24 Left 949035692 2:241814844-241814866 CCCAGGTCCCTGGACGTCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 949035705 2:241814891-241814913 GTGGGGTGCCCTGCACGTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949035692 Original CRISPR ACCAGGACGTCCAGGGACCT GGG (reversed) Intronic
900478453 1:2887068-2887090 ACCAGGGCTTCCCGAGACCTTGG + Intergenic
900486106 1:2923558-2923580 CCCAGGAAGCCCAGGGGCCTGGG + Intergenic
900593463 1:3469887-3469909 ACCAGGACGTCCAGGCACAGAGG + Intronic
900875255 1:5337975-5337997 GACAGGAAGTCCAGGGACCTGGG - Intergenic
901739882 1:11335005-11335027 ACCAGGATGGCCACAGACCTGGG - Intergenic
903659295 1:24967004-24967026 ACCAGGAGGTCAAGGCCCCTTGG - Intergenic
906114694 1:43348944-43348966 ACCACGAGCTCCAGGGACCTTGG - Exonic
906514102 1:46428902-46428924 AGCAGGCGCTCCAGGGACCTGGG - Intergenic
906895372 1:49764561-49764583 ATCAGGACGTCTAGGGGCCTGGG + Intronic
907551641 1:55309944-55309966 ACCACAAAGTCCAGAGACCTCGG - Intergenic
909917003 1:81332968-81332990 ACTAGGAAGTTCAGCGACCTGGG + Intronic
911700019 1:100941817-100941839 ACCAGGCACTCCAGGGGCCTTGG - Intronic
912742277 1:112211604-112211626 ACCAGGACATCCTGGAAGCTAGG + Intergenic
913240590 1:116826275-116826297 ACCAGGATGTGTAGGGACCTGGG - Intergenic
915466831 1:156103170-156103192 ACCAGGAAGTCCTGGGCTCTAGG + Intronic
919847932 1:201653332-201653354 ACTAGGAAGTCCAGGTTCCTGGG - Intronic
922695561 1:227729250-227729272 GGCAGGAACTCCAGGGACCTGGG - Intronic
1064555172 10:16540689-16540711 ACCAGAGCCTCCAGGGACCTTGG - Intergenic
1064923315 10:20542445-20542467 GACTGGATGTCCAGGGACCTGGG + Intergenic
1065212773 10:23420654-23420676 ACAAGGACATCTGGGGACCTTGG + Intergenic
1065991899 10:31018773-31018795 ACAAGGTCATCCAGGAACCTAGG + Intronic
1069890548 10:71649568-71649590 GCCATAAGGTCCAGGGACCTGGG - Intronic
1070849623 10:79552858-79552880 AGCAGGACATCCAGGAGCCTGGG - Intergenic
1077228014 11:1446807-1446829 ACCAGGAGGTCCAGGAGCCCGGG + Intronic
1077290077 11:1785030-1785052 ACCAAGACCACAAGGGACCTTGG - Intergenic
1081662604 11:44897079-44897101 CCCAGGAAGACCTGGGACCTGGG - Intronic
1082818940 11:57530521-57530543 ACCTGAACCTCCAGGGCCCTGGG + Intronic
1083057509 11:59837172-59837194 ACCAGGACTACAAGTGACCTGGG + Exonic
1083598577 11:63932237-63932259 GCCAGGGAGTCCAGGGGCCTCGG + Intergenic
1084943422 11:72626314-72626336 CCCGGGGCGTGCAGGGACCTGGG - Intronic
1088683544 11:112265794-112265816 ACAAGGGCGTCCAGGGAGCTGGG + Intronic
1091722962 12:2826723-2826745 ACCAGGAGGTCCAGGGACATAGG + Exonic
1096606252 12:52768527-52768549 AGCAGGACCTCCATGGCCCTGGG + Exonic
1096817831 12:54212828-54212850 ACCAGGGAGGCCAGGGACATTGG + Intergenic
1097038080 12:56137252-56137274 ACCAGGACAACCAGGCACCGTGG - Exonic
1101874930 12:108591715-108591737 ACCAGGAAGTCCAGGGACATGGG - Exonic
1105849119 13:24318822-24318844 ACCAGGACGTCCTGGCAGCCCGG + Exonic
1107435299 13:40376294-40376316 AACAGGACTCCCAGGGACCAGGG + Intergenic
1107966539 13:45603095-45603117 ACCAGGACTTCCAAGGTCCTAGG + Intronic
1109699718 13:66009583-66009605 ACCAGGACTCCCAGGGGCTTAGG + Intergenic
1112004668 13:95243998-95244020 ACCAGGACACCTAGGAACCTAGG + Intronic
1113464932 13:110506419-110506441 ACCAGGCCGTCCAGGGAGCCCGG + Exonic
1114136028 14:19852050-19852072 TCCAGGAGGTCTGGGGACCTAGG + Intergenic
1115819915 14:37202968-37202990 ACTAGTACGTCCAGCTACCTGGG + Intronic
1118616330 14:67576716-67576738 AGCAGGCTTTCCAGGGACCTGGG + Intronic
1118849516 14:69573267-69573289 ACCAGGTCGGCCAGGGCCCGTGG + Exonic
1121336012 14:93077859-93077881 ACCAGGACCTGCAGGGACCGAGG + Intronic
1124350598 15:28953043-28953065 ACCAGGACTTCCAGGTCCCAGGG - Intronic
1129449142 15:75640250-75640272 ACCTGGACGGCCTGGGACCCTGG + Exonic
1129480351 15:75820162-75820184 ACCTGTACCTCCAGGGACCCAGG - Intergenic
1130509150 15:84574051-84574073 ACCTGTACCTCCAGGGACCCAGG + Intergenic
1132689452 16:1175977-1175999 ACCAGGATGTCCTGGGAGCATGG - Intronic
1140937254 16:79684776-79684798 ACCAGGAGGTCCAGTGTCCAAGG - Intergenic
1141551366 16:84808817-84808839 ACCAAGACGACCAGGGATTTGGG - Intergenic
1142235823 16:88922088-88922110 GCCAGGACATCCCGGGAGCTGGG + Intronic
1142485714 17:246635-246657 ACCAGAACGCCCAGGGACACTGG + Intronic
1142664840 17:1456505-1456527 CCCAGGTCGTCCAGGAACCGGGG - Intronic
1143166520 17:4899775-4899797 ATCAGGGTGTCCAGGGAGCTGGG - Exonic
1143692504 17:8581172-8581194 ACCATGACCTCCAGGGTCCATGG - Intronic
1144762791 17:17716890-17716912 ACCAGGCCACCCAGGGACATCGG - Intronic
1145883758 17:28369177-28369199 ACCAGGTCCTGCAGGGCCCTGGG + Intronic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147691552 17:42318588-42318610 ACCAAGAGGTCAAGGAACCTTGG + Intronic
1147962704 17:44177633-44177655 AGCAGGACTTCCAGGGCCCGAGG - Exonic
1148688203 17:49512541-49512563 ACCAGGAAGTGAAGGCACCTGGG - Intronic
1152627069 17:81392728-81392750 ACCAGGACTCCCAGGGGCTTGGG + Intergenic
1152809409 17:82374448-82374470 ACCAGGTCCTCCAGGGAGCTGGG - Exonic
1153252824 18:3139659-3139681 CAGAGCACGTCCAGGGACCTGGG - Intronic
1160144446 18:76352149-76352171 GCCAGGATGTCCAGAGAGCTGGG + Intergenic
1160594477 18:79964455-79964477 CCCAGGCCGTCCCGGGGCCTCGG + Intergenic
1160662830 19:308984-309006 CCCAGGACGTCCTGGGATCGTGG - Intronic
1160662833 19:308991-309013 CCCAGGACGTCCTGGGACCCCGG + Intronic
1163582966 19:18149268-18149290 GCCAGGCCGTGCAGGGAGCTGGG - Exonic
1164280318 19:23763107-23763129 GCCAGGACATCCTGGAACCTGGG + Exonic
1165165314 19:33849775-33849797 AGCATGCCATCCAGGGACCTGGG + Intergenic
1165861559 19:38911913-38911935 ACCGGGACGCCCATGGAGCTGGG - Intronic
1165864959 19:38931282-38931304 ACCAGGACATCCTGCCACCTGGG - Exonic
1166131486 19:40748519-40748541 ACTGGGACATCCAGGGACCCAGG - Intronic
1167044248 19:47040611-47040633 AGAAGGACTTCCAGGGACCAGGG - Intronic
1167703691 19:51065842-51065864 TCCAGGACGTGCTGGGACCTAGG + Intergenic
925083714 2:1091291-1091313 CCCAAGTGGTCCAGGGACCTGGG - Intronic
932576296 2:72964074-72964096 AGTAGGAAGCCCAGGGACCTTGG + Intronic
933119863 2:78523098-78523120 ACCATGTCGCCCAAGGACCTAGG + Intergenic
934041466 2:88130677-88130699 CCTAGGATGTCTAGGGACCTGGG - Intergenic
934762028 2:96861694-96861716 GCCAGGACCTCCAGGGACTCAGG - Intronic
937877309 2:126835480-126835502 ACAGGGACCTCCAGGAACCTGGG + Intergenic
938141083 2:128795116-128795138 ACCCTAAAGTCCAGGGACCTGGG - Intergenic
943250754 2:185518750-185518772 ACCAGGCCGTCCAGGCTCCCTGG + Intergenic
944020194 2:195093743-195093765 TCCACGAGGTCCAGGGACTTAGG - Intergenic
947165845 2:227261097-227261119 ACCAGGACTTCCAGGAACTCCGG - Exonic
947950391 2:234142111-234142133 ATCAGGACCTCCTGGGAACTGGG + Intergenic
948456043 2:238105094-238105116 ACCAGGACTTCCAGGGAGAGAGG - Intronic
948708906 2:239813259-239813281 TCCAGGCCGTCCAGGGCCCGGGG + Intergenic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1173673477 20:44813931-44813953 ACCAAGAAGTCCAGGCACATAGG - Intergenic
1174038459 20:47682747-47682769 GCCAGGAAATCCAGGGAGCTGGG - Intronic
1176092908 20:63326793-63326815 GCGAGGACCTCCAGGGACCGTGG + Exonic
1178290576 21:31364642-31364664 ACCATGATGGCCAGGGACCATGG + Intronic
1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG + Intronic
1181457280 22:23066959-23066981 ACCAGGAATTCCAGGGTCCTAGG + Intronic
1181498667 22:23302769-23302791 GCCTGGACCTCCAGGGACCAGGG + Intronic
1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG + Intronic
1184246443 22:43238076-43238098 AACAGGAAGCCCAGGGAGCTGGG - Intronic
950781960 3:15399763-15399785 ACCATGACATTCAGGGACCAGGG + Intronic
954409614 3:50364748-50364770 ACCAGGACGCCCAGCGACGGCGG + Exonic
960928143 3:122816687-122816709 ACGAGGTTGTCTAGGGACCTGGG + Intronic
962239888 3:133743459-133743481 ACCAGGACATGCAGGGGCCAAGG - Intergenic
964559097 3:157973855-157973877 ACCAGAACGTCAAATGACCTTGG - Intergenic
968420438 4:479530-479552 AACAGGACGTTCAGGGACCAGGG + Intronic
968662798 4:1805746-1805768 ACCAGCACGTACAGGGGCCCTGG - Exonic
968844899 4:3035535-3035557 GCCAGGACGAGCAGGGCCCTAGG + Intronic
969500017 4:7546968-7546990 ACCAGGGCCTCCCTGGACCTGGG - Intronic
977059657 4:92241221-92241243 TCCAGGAGATCCAGAGACCTGGG - Intergenic
979014740 4:115419086-115419108 AGCAGGACATGCAGGGCCCTTGG - Intergenic
985827695 5:2205048-2205070 CCCAAGACCTCCAGGGTCCTTGG - Intergenic
991491540 5:67188414-67188436 ACAAGGACATCCCAGGACCTTGG + Intronic
995891658 5:116960368-116960390 ACCAGGAAGTACAGTGTCCTTGG + Intergenic
998127640 5:139635271-139635293 CCTGGGACATCCAGGGACCTGGG + Intergenic
1001752991 5:174145764-174145786 ACCAGAACGCCCAGGGAATTGGG + Intronic
1003313982 6:4994803-4994825 GCCAGGATGTCCAGGGACCGGGG - Exonic
1004035749 6:11921115-11921137 ACCAGGACACCCAGGGCCCTTGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1017717349 6:157222228-157222250 CCCAGGACTTCCAGGGATGTGGG - Intergenic
1025715217 7:63949888-63949910 AACAGGACAACCAGGCACCTGGG + Intergenic
1027124228 7:75544653-75544675 ACCAGGCCTTCCAGCGTCCTAGG + Intronic
1028476568 7:91260334-91260356 AACTGGAAGTCCATGGACCTTGG + Intergenic
1029562039 7:101309030-101309052 AGCAGGAGGGCCAGGGGCCTGGG + Intergenic
1030257627 7:107528788-107528810 ACCTGGAGGTTCAGGGACCCTGG - Intronic
1033355952 7:140600477-140600499 AGCAGGACTTCCAGGGACATGGG + Intronic
1033879402 7:145862558-145862580 ACCAGGACGTCCAGCCTCCCTGG - Intergenic
1035063739 7:156090629-156090651 ACCTGGAAGGCCAGGAACCTTGG - Intergenic
1035369252 7:158368629-158368651 ACAGGGACGTCCAAGGACCAAGG + Intronic
1037934005 8:22902414-22902436 ACCAGGTGATCCAGGGAACTTGG - Intronic
1038742998 8:30231970-30231992 ACTAGGACATCCAGGGAACCAGG + Intergenic
1039434571 8:37551157-37551179 TCAAGGAAGTCCAGGGAGCTGGG - Intergenic
1039596137 8:38791444-38791466 ACCCTGACTTCCAGGGTCCTTGG + Intronic
1044316045 8:90751148-90751170 ATCAGGCCATCTAGGGACCTGGG - Intronic
1047959600 8:130001302-130001324 TCCTGGACGTCCAGGGAGCAAGG - Intronic
1048312198 8:133332544-133332566 ACCAGGAAGTCCAGGTACGGTGG - Intergenic
1048978052 8:139684067-139684089 TCCAGGACCACCTGGGACCTGGG - Intronic
1050281983 9:4060047-4060069 ACCAGGTTGGCCAGGAACCTTGG - Intronic
1053379361 9:37636220-37636242 ACCAGGGGATCCAGGGCCCTGGG - Intronic
1054855136 9:69891343-69891365 TCCAGGAAGTCCAGGGTCCCGGG - Intronic
1056788938 9:89612984-89613006 ACCAGCACGTCCAAGGCCCCGGG - Intergenic
1060214504 9:121730569-121730591 GTCAGCACCTCCAGGGACCTAGG + Intronic
1061094239 9:128445324-128445346 ACCAGCAAATCCAGGGACCCAGG - Intergenic
1061617899 9:131792239-131792261 ACCAGCAGGTCCAGAGGCCTGGG + Intergenic
1196193580 X:112818330-112818352 ACATGGCCTTCCAGGGACCTTGG + Intronic
1197756691 X:130000400-130000422 ACCAGGATGTTCAGGGAACGGGG + Intronic
1200276750 X:154740722-154740744 AAGAGGAAGGCCAGGGACCTGGG - Intronic
1201730168 Y:17193759-17193781 CCCAGGATCTCCACGGACCTCGG + Intergenic