ID: 949037632

View in Genome Browser
Species Human (GRCh38)
Location 2:241824519-241824541
Sequence AAGAAGAAGAAGAAGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949037632_949037634 19 Left 949037632 2:241824519-241824541 CCTGACTACTTCTTCTTCTTCTT No data
Right 949037634 2:241824561-241824583 AGAGTCTCTGTCTTCCAGGCTGG 0: 4
1: 55
2: 622
3: 1875
4: 4104
949037632_949037633 15 Left 949037632 2:241824519-241824541 CCTGACTACTTCTTCTTCTTCTT No data
Right 949037633 2:241824557-241824579 AGATAGAGTCTCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949037632 Original CRISPR AAGAAGAAGAAGAAGTAGTC AGG (reversed) Intergenic
No off target data available for this crispr