ID: 949041565

View in Genome Browser
Species Human (GRCh38)
Location 2:241852136-241852158
Sequence CGGGAGTGAGGGCCGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949041565 Original CRISPR CGGGAGTGAGGGCCGCCAGC AGG Intronic
900116020 1:1028288-1028310 CGGGAGAGAGAACGGCCAGCAGG - Intronic
900176182 1:1292423-1292445 GGGGGGTGAGACCCGCCAGCAGG + Exonic
900595322 1:3477719-3477741 CCCGACTGAGGGCAGCCAGCTGG + Intronic
901154046 1:7123666-7123688 CGGGAGTGAGGGCAGTGACCAGG - Intronic
904003179 1:27349932-27349954 TGGGAGTCAGGGCCGCTCGCAGG - Intronic
904035645 1:27557199-27557221 AGGAAGGGAGGGCCGCCGGCAGG - Intronic
904165634 1:28553137-28553159 CGTGAGTGAGGGCAGCCGTCCGG + Exonic
904311069 1:29629941-29629963 CTGCAGCGAGGGCCCCCAGCAGG - Intergenic
904812170 1:33170583-33170605 GGGGAGAGAAGGCCCCCAGCAGG + Intronic
905685194 1:39902410-39902432 CAGGGCTGAGGGCCGCCAGGTGG - Intergenic
906150147 1:43582830-43582852 CAGGGCTGAGGCCCGCCAGCAGG - Intronic
906727169 1:48052480-48052502 TGGGAGTGAGAGCCGACAGAGGG - Intergenic
910338049 1:86155828-86155850 CGTGAGGAAGGGTCGCCAGCGGG - Intronic
910837962 1:91534618-91534640 GTACAGTGAGGGCCGCCAGCAGG - Intergenic
911664793 1:100539910-100539932 GGGGAGTGCAGGCGGCCAGCTGG + Exonic
913317225 1:117563476-117563498 CGGGAGTGAGGGTGGGAAGCGGG - Intergenic
917533349 1:175856308-175856330 TTGGAGTTAGAGCCGCCAGCAGG + Intergenic
917578589 1:176349637-176349659 GTGGAGTGAGAGGCGCCAGCGGG - Intergenic
919887601 1:201946262-201946284 CGGGAGACAGGGTCTCCAGCAGG + Exonic
923539022 1:234875043-234875065 CTAGAGTCAGGGCCGCAAGCTGG + Intergenic
1064325702 10:14349299-14349321 CAGGAGGCAGGGCTGCCAGCAGG + Intronic
1064348676 10:14556844-14556866 GGGGAGTGAGGGCCGCTGCCAGG - Intronic
1066022717 10:31319356-31319378 CGGGGGTGAGGGGGGCGAGCCGG + Intronic
1072049349 10:91688124-91688146 CTGGAGTGAGGGCCTCATGCTGG - Intergenic
1073432239 10:103494120-103494142 CGGGAGCGGGGGCCACAAGCAGG - Exonic
1075438398 10:122461435-122461457 CGGGAGGGAGGGCGGGCGGCTGG - Intergenic
1075716962 10:124561364-124561386 TGGGAATGAGGTCCCCCAGCTGG + Intronic
1076702620 10:132282035-132282057 CTGGAGGCAGAGCCGCCAGCTGG + Intronic
1076795370 10:132795523-132795545 CGGGATTGTGGGGGGCCAGCAGG + Intergenic
1079844047 11:25441683-25441705 CAGGAGTGAACGCAGCCAGCTGG - Intergenic
1081570630 11:44288648-44288670 CGGGAGTGAGGGCTTCCAGAGGG - Intronic
1084182189 11:67452343-67452365 CGAGGCTGAGGGCGGCCAGCAGG + Exonic
1084186570 11:67475923-67475945 GGGCTGTGAGGGCTGCCAGCAGG - Intergenic
1084591949 11:70095739-70095761 CGGGGGTGAGGGGCTCCTGCGGG - Intronic
1084698131 11:70768543-70768565 CAGGAGTGAGGGCCGGAAGGAGG + Intronic
1084951803 11:72670555-72670577 AGGGAGTGAGGACAGACAGCAGG - Intronic
1085387884 11:76167628-76167650 CAGTGGTGAGGGCTGCCAGCTGG - Intergenic
1085941047 11:81207435-81207457 AGAGAGCGAGGGCTGCCAGCAGG - Intergenic
1089659617 11:119977581-119977603 TGGGAGTGGGGGCAGCCTGCTGG - Intergenic
1090410938 11:126509224-126509246 TGTGAGTGAGGGTCCCCAGCAGG - Intronic
1091762786 12:3098118-3098140 TAGGAGTCAGGGCCCCCAGCTGG + Intronic
1101336429 12:103801099-103801121 CAGGAGTGAGTGCTGCCAGCTGG - Intronic
1102310642 12:111842189-111842211 CGTGCGTGAGGGCGGCCGGCGGG + Intronic
1104847082 12:131852048-131852070 CGGGCGGGCGGGGCGCCAGCTGG + Intergenic
1105683356 13:22752301-22752323 CGAGAGGGAGGGTCGCCAGAGGG - Intergenic
1106011471 13:25828023-25828045 CGGGAATGTGGACCACCAGCTGG - Intronic
1111414412 13:87920130-87920152 CAGGAGTGATGGGCTCCAGCAGG - Intergenic
1114306588 14:21429200-21429222 CTTGAGTCAGGGCTGCCAGCTGG + Exonic
1115494113 14:33985443-33985465 AGGAACTGAGGGCAGCCAGCAGG - Intronic
1116653695 14:47626387-47626409 GGGCTGTGAGGGCTGCCAGCTGG - Intronic
1117727420 14:58687782-58687804 GGGCTGCGAGGGCCGCCAGCAGG + Intergenic
1120229845 14:81829969-81829991 CGTGAGCGAGGGCTGCCAGCAGG + Intergenic
1120704863 14:87735282-87735304 AGTGAGCGAGGGCTGCCAGCAGG + Intergenic
1121319675 14:92984262-92984284 CGGAAGTGAGGGCGGCCAGAAGG + Intronic
1121733926 14:96205032-96205054 AGGGAGGGAGGGCAGGCAGCGGG + Intronic
1122027088 14:98885985-98886007 CGGGCGTGTGGGCCGGCAGTGGG + Intergenic
1122820711 14:104343409-104343431 AGGGACAGAGGGCCTCCAGCTGG - Intergenic
1125510274 15:40288959-40288981 AGGGAGCGAGGGTGGCCAGCAGG - Intronic
1125677868 15:41512097-41512119 CCGGAGTGAGCGCAGCCAGTGGG - Exonic
1127982550 15:64045772-64045794 TGGGCGTGGGGGCGGCCAGCAGG - Intronic
1128345725 15:66851309-66851331 CGGGAGTGAGCGGGGCCAGGCGG + Intergenic
1129724473 15:77894490-77894512 GGGCTGTGAGGGCTGCCAGCAGG + Intergenic
1131056633 15:89378882-89378904 CAGGAGAGAAGGGCGCCAGCAGG + Intergenic
1132510398 16:338078-338100 AGGGAGAGAGGGCCGCCTGTTGG - Intronic
1132552968 16:560815-560837 GGGGAGGGAGGGCCGCCCTCAGG + Intronic
1132569244 16:636988-637010 CGGGCGTGAAGGACGCGAGCTGG + Intronic
1132578848 16:676047-676069 AGGGAGGGAGGGCGGGCAGCTGG + Intronic
1132681711 16:1145127-1145149 AGGGAGGGAGGGCTGACAGCAGG - Intergenic
1133752681 16:8736863-8736885 CTGGAGACAGAGCCGCCAGCAGG + Intronic
1135942766 16:26836584-26836606 GGGCTGTGAGGGCTGCCAGCAGG + Intergenic
1136243982 16:28962777-28962799 AAGGACTGTGGGCCGCCAGCAGG - Intronic
1136365103 16:29806224-29806246 CGGGAGGGAGGGCGGGCAGGAGG - Intronic
1139489686 16:67279622-67279644 GGGGCGTGAGTGTCGCCAGCGGG + Exonic
1139968216 16:70757319-70757341 CTGGACTCAGGGCGGCCAGCTGG + Intronic
1140478658 16:75251230-75251252 CGGGCGCGGGGGCCGCCAGCCGG - Intronic
1142141944 16:88476420-88476442 AGGGAGAGAGGGCCGCCAAGTGG + Intronic
1142196156 16:88740189-88740211 TGGGAGTGAGGGTCGCCCGGGGG + Intronic
1142278202 16:89133907-89133929 TGGCAGTGGGGGCTGCCAGCAGG - Intronic
1142363517 16:89638174-89638196 GGGGAGCGAGGGAGGCCAGCAGG - Exonic
1143108493 17:4541084-4541106 CAGGAGTGTGGGCAGCCATCAGG - Intronic
1143344877 17:6242161-6242183 GGCCAGTGAGGCCCGCCAGCTGG - Intergenic
1143461008 17:7103422-7103444 TGGGAGGGAGGGCTGGCAGCAGG - Intronic
1143582715 17:7835967-7835989 TGGGAGTGTGGGGCGCCAGCTGG - Intergenic
1145912799 17:28552306-28552328 CGCGAGGGAGCGCCGCCCGCGGG - Intronic
1145979923 17:29005406-29005428 CGGGACCACGGGCCGCCAGCTGG + Intronic
1145995120 17:29100510-29100532 CGGGCGTGGGGGCACCCAGCTGG - Intronic
1147442607 17:40456575-40456597 CGAGAGTGAGGCCTGCCAGCAGG + Exonic
1148023295 17:44568057-44568079 AGTGAGCGAGGGCTGCCAGCAGG - Intergenic
1149865689 17:60149909-60149931 CGGGAGGGAGCCCCGACAGCTGG - Intergenic
1149994757 17:61400566-61400588 CGGGAGGTAGGGCTGCCGGCCGG + Exonic
1151346900 17:73507846-73507868 CTGGAGTGTGGGCTGGCAGCAGG - Intronic
1151359033 17:73577461-73577483 GGGGAGAGAGGGTCCCCAGCTGG + Intronic
1151508529 17:74544315-74544337 CGTGAGGGAGGGCCCACAGCGGG + Intronic
1152578955 17:81157599-81157621 CGGAAGTGAGTTCCACCAGCTGG + Intronic
1159583467 18:70261013-70261035 CACCAGTGAGGGCAGCCAGCAGG + Intergenic
1160738870 19:676924-676946 CGGGAGCCAGGCCCTCCAGCTGG + Intronic
1161160145 19:2757254-2757276 TGGCAGTGAGGGCAGCCAGCAGG - Intronic
1162141106 19:8586104-8586126 CCAGAGTGAGTGCCGCCAGGGGG - Exonic
1163602475 19:18257401-18257423 TGGGACTCAGGGCAGCCAGCTGG + Exonic
1163772927 19:19201711-19201733 CCTGAGTGAAGGCCGCCTGCCGG + Exonic
1164551061 19:29212877-29212899 CCGGGGCGAGGGCCGCGAGCAGG - Intronic
1165154122 19:33777217-33777239 GAGGAGTGAGGGACGCCAGCAGG - Intergenic
1167456995 19:49601603-49601625 TGGGCGTGGGGGCCACCAGCGGG - Exonic
925174786 2:1775128-1775150 CGGGCCTGAGGGCTGCCTGCTGG + Intergenic
926063626 2:9820351-9820373 CGGGAGTGGGGGCGGGGAGCAGG + Intergenic
927026883 2:19077391-19077413 CGGAAGTGAGGGCAGCCTGAAGG + Intergenic
933835329 2:86241097-86241119 GGGGAGTCAGGGCCACCAGGAGG + Intronic
936403718 2:112184483-112184505 TGGGAGGGACGGCCTCCAGCTGG + Intronic
938034749 2:128027240-128027262 CGGGGGTGAGTGGGGCCAGCGGG - Exonic
940830026 2:158456903-158456925 CGGGCGGGAGGGCTGGCAGCGGG + Intergenic
944495776 2:200306565-200306587 CGGGAGCGAGGGGCGCCGGCTGG + Intronic
949041565 2:241852136-241852158 CGGGAGTGAGGGCCGCCAGCAGG + Intronic
1171423063 20:25031984-25032006 TGGGAGTGAAGACCGCAAGCAGG + Intronic
1172012333 20:31852839-31852861 CAAGAGTGAGTGCAGCCAGCTGG - Intronic
1173492673 20:43495814-43495836 CTGGATTGAGGGATGCCAGCTGG - Intergenic
1174216622 20:48921245-48921267 CGGGAGTAAGGGGCGTCAGGAGG - Intergenic
1175256402 20:57650347-57650369 GGGGTGGGAGGGCCCCCAGCTGG - Exonic
1175439605 20:58981420-58981442 CGGGAGTGGGGCCGGCCCGCCGG - Intronic
1176255123 20:64147744-64147766 AGGGAGTGAGTGCTGCCAGTGGG + Intergenic
1179558097 21:42193563-42193585 CGGCAGTGAGGGCAGCCTGATGG + Intergenic
1179708074 21:43193979-43194001 GGGGAGGAAGGGCTGCCAGCAGG + Intergenic
1180285458 22:10741538-10741560 CGGGTGCGAGGGCTGCCCGCAGG + Intergenic
1181130398 22:20727928-20727950 CTGGAGTGAGGGGAGCCAGGGGG + Intronic
1182416202 22:30223030-30223052 CGGGTGGGAGGGACGCCATCCGG - Intergenic
1183577450 22:38700920-38700942 CTGGAGTGCGCGCCGCCAACTGG + Intronic
1184586297 22:45450338-45450360 CGGGTCTGAGGGACACCAGCAGG - Intergenic
1185341762 22:50294141-50294163 CAGGAGGGAGGGCGGGCAGCAGG + Intronic
950630411 3:14278463-14278485 CGGGAAGGAGGGCTGCCTGCAGG - Intergenic
951142324 3:19178638-19178660 AGGGAGTGTGGTCCTCCAGCAGG + Intronic
952076239 3:29701417-29701439 GGCGAGCGAGGGCTGCCAGCAGG - Intronic
954112285 3:48440787-48440809 CGGCAGTAAGGGCCGGGAGCTGG + Intronic
954382560 3:50227415-50227437 CGTGAGTGGGGGCCGCGAGGCGG + Intronic
954807478 3:53228960-53228982 GGGAAGTGATGGCTGCCAGCAGG + Intronic
955398714 3:58575863-58575885 CAGGAGGGAAGGCCACCAGCTGG - Intronic
957970310 3:87375160-87375182 AGTGAGCGAGGGCTGCCAGCAGG - Intergenic
960479463 3:118171238-118171260 AGCGAGCGAGGGCTGCCAGCAGG - Intergenic
961645777 3:128392123-128392145 TGGGCATGAGGGCTGCCAGCAGG - Intronic
962444567 3:135453099-135453121 CGGGAGGAGGGGCCGTCAGCAGG - Intergenic
968234241 3:197022402-197022424 CTGGAGTGTGGGGCACCAGCAGG + Intronic
968493702 4:903878-903900 TGGGCGTGAAGGCCCCCAGCAGG + Intronic
971171969 4:24242762-24242784 TGGGAGTGATGGGAGCCAGCAGG - Intergenic
972602128 4:40582013-40582035 CAGGAGTGAGAGGCGCCAACCGG - Intronic
975991230 4:80262246-80262268 CTGGACTGAGGGCCCCCACCAGG + Intergenic
988489215 5:31692493-31692515 GGGCTGTGAGGGCTGCCAGCAGG + Intronic
989167598 5:38446346-38446368 CGGGAGAGAAGGCAGCCACCGGG - Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
992080365 5:73230648-73230670 CGGGCGTGAGCCCCTCCAGCTGG - Intergenic
996535252 5:124570765-124570787 AGGGACTGACGGCCCCCAGCTGG - Intergenic
997445141 5:133934991-133935013 GGTGAGTGGGGGCGGCCAGCAGG + Intergenic
997616073 5:135247157-135247179 CGGGGGAGTGGGCTGCCAGCCGG - Intronic
1002417862 5:179130174-179130196 GGGGAGTGGGGGCAGCTAGCTGG + Intronic
1003749500 6:9040605-9040627 AGCGAGCGAGGGCTGCCAGCAGG - Intergenic
1003956593 6:11170906-11170928 GGGCTGTGAGGGCTGCCAGCAGG - Intergenic
1004663233 6:17728604-17728626 CAAGAGTGAGGGCTGCCAGCAGG - Intergenic
1005561360 6:27045118-27045140 GGGCTGTGAGGGCTGCCAGCAGG - Intergenic
1006436497 6:34028405-34028427 CGGGAGTCAGGGCCCTCAGTCGG - Intronic
1008274446 6:49526728-49526750 CCAGCGTGAGGGCCACCAGCCGG - Exonic
1009690868 6:67030923-67030945 AGCGAGTGAGGGCTGCTAGCAGG - Intergenic
1017633809 6:156424079-156424101 AGGAAGTGAGGGCCTCCAGGGGG + Intergenic
1018091209 6:160348193-160348215 CGGGAGGGACGGCCGCGAGCCGG - Intergenic
1018347833 6:162921280-162921302 GAGCAGTGAGGGCCGCCAGGTGG + Intronic
1019367796 7:644286-644308 CGGGAGTGAGTGATTCCAGCAGG - Intronic
1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG + Intronic
1019573622 7:1725450-1725472 CGGGAGGGAGGGAGGGCAGCAGG + Intronic
1020141554 7:5614723-5614745 CGGGAGGGAGGGCTGCCTCCCGG + Intergenic
1024001850 7:45195004-45195026 GGGCAGTGAGGGAAGCCAGCAGG + Intergenic
1025947410 7:66115071-66115093 CGGGAGTGAGGGCAGCGGGCCGG + Intronic
1027234703 7:76291408-76291430 AGGGCATGAGGGGCGCCAGCTGG - Intergenic
1028193149 7:87875848-87875870 CGGGAGTGAGGGCGGCCCCGGGG - Intronic
1029254706 7:99261672-99261694 CGGCAGTGATGGCAGCCAGCTGG - Intergenic
1032983585 7:137313109-137313131 GGGGAGTGAGGGCTGCCAGGAGG - Intronic
1033758673 7:144418426-144418448 GGGCTGTGAGGGCTGCCAGCAGG + Intergenic
1034411662 7:150945403-150945425 GGGAGGTGAGGGCCCCCAGCTGG + Exonic
1035784951 8:2253013-2253035 GGGGAGGGCGGGCCCCCAGCAGG + Intergenic
1036182889 8:6600287-6600309 AGGGAGAGAGGGTCCCCAGCAGG + Intronic
1038017657 8:23529017-23529039 CGGGAGCGTGGGCAGCCAGGCGG + Exonic
1038847681 8:31244625-31244647 AGTGAGCGAGGGCTGCCAGCAGG + Intergenic
1039068654 8:33631510-33631532 GGGCTGTGAGGGCTGCCAGCAGG - Intergenic
1040622322 8:49103547-49103569 GGGGAGTGAGGGCTGCCAGCAGG + Intergenic
1044229428 8:89757663-89757685 CAGGCGGGAGGGCCGCGAGCGGG + Intergenic
1044243459 8:89913307-89913329 CAGGAGTGAGGGAAGACAGCCGG + Intronic
1045064940 8:98436340-98436362 CGGGAGTGAGGGCGTCGGGCAGG - Intronic
1045583307 8:103501143-103501165 CGGGAGGGAGGGCGGCGAACTGG - Intronic
1049021145 8:139958434-139958456 CGGGGGTGGGGGCAGCCACCTGG - Intronic
1049724823 8:144140875-144140897 TGGGAGTGAGCGCCTCCAGGAGG - Intergenic
1053475159 9:38377408-38377430 GGGCTGTGAGGGCTGCCAGCAGG - Intergenic
1056216191 9:84408320-84408342 AGGGAGCGAGGGCTGCCAGCAGG - Intergenic
1060695610 9:125706893-125706915 GGGGTGAGAGGGCCGCCAGGTGG + Intronic
1061164980 9:128916953-128916975 CGGGAGAGCAGGCCTCCAGCTGG + Exonic
1061790662 9:133057309-133057331 CAGGAGTGAGGGCCAGCTGCAGG + Intronic
1061954821 9:133955937-133955959 CCGGAGCGGGGGCCTCCAGCAGG - Intronic
1061973418 9:134056587-134056609 AGGGAGGGAGGGCAGCCAGAGGG + Intronic
1062137238 9:134935832-134935854 ATGGAGTCAGGGCCGCGAGCCGG + Intergenic
1062437599 9:136553505-136553527 TATGAGTGAGGGCTGCCAGCAGG - Intergenic
1203731819 Un_GL000216v2:98604-98626 CTGGTGCGAGGGCTGCCAGCAGG + Intergenic
1185450096 X:277126-277148 TGGGAGTGGGGGCCGCCCCCGGG + Intronic
1190109143 X:47578727-47578749 CGAGAGGGAGGGCCACCAGAGGG - Intronic
1195100618 X:101551347-101551369 AGGGAGTGAGGGCCGGGGGCGGG + Intronic
1195282264 X:103347988-103348010 CGGGAGGGAGGTGCTCCAGCAGG - Intergenic
1202379826 Y:24266845-24266867 GGAGAGTGAGGGCCGCGAGTTGG - Intergenic
1202490956 Y:25403276-25403298 GGAGAGTGAGGGCCGCGAGTTGG + Intergenic