ID: 949044810

View in Genome Browser
Species Human (GRCh38)
Location 2:241867502-241867524
Sequence CCCCTCTTCTTCGGCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949044810_949044819 4 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044819 2:241867529-241867551 TCATGGCTGGCTGATTTGTGAGG 0: 1
1: 0
2: 2
3: 18
4: 273
949044810_949044818 -9 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044818 2:241867516-241867538 GAAGAGGGGGTGCTCATGGCTGG 0: 1
1: 0
2: 3
3: 18
4: 267
949044810_949044823 29 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044823 2:241867554-241867576 GCCACGTAAGCAGCTCTTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 73
949044810_949044821 6 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044821 2:241867531-241867553 ATGGCTGGCTGATTTGTGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 178
949044810_949044825 30 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96
949044810_949044820 5 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044820 2:241867530-241867552 CATGGCTGGCTGATTTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 266
949044810_949044822 7 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044822 2:241867532-241867554 TGGCTGGCTGATTTGTGAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949044810 Original CRISPR CCCCTCTTCTTCGGCGGGGA TGG (reversed) Intergenic
900677802 1:3899811-3899833 CCCCCCTTCTCCCGCGGGCATGG + Intronic
901110018 1:6786086-6786108 CCCCTGCTCTCCGGCGGGCAGGG + Intronic
902933569 1:19747897-19747919 CCCCTTTGCTGCGGCTGGGATGG + Intronic
902987483 1:20163884-20163906 CCCCTGTTCTTCCACTGGGAGGG - Intronic
903897953 1:26620998-26621020 GCCCTATTCTTCGTGGGGGAGGG + Intergenic
906571475 1:46845429-46845451 CCCCTCTACTTCCCAGGGGATGG + Intergenic
915249851 1:154580167-154580189 CCACTCTCCTGAGGCGGGGATGG + Intergenic
915720580 1:157982210-157982232 CCCCTCATATTAGGTGGGGAAGG - Intergenic
924382092 1:243474567-243474589 CCCCTCTCCCTCGCCGGGCAGGG - Intronic
1076196029 10:128519008-128519030 CCCCTCTGCTGAGGCAGGGAAGG + Intergenic
1076859244 10:133132802-133132824 CCCCACTGGTTCTGCGGGGAAGG + Intergenic
1088810340 11:113387733-113387755 CGGCTCCTCTTGGGCGGGGAAGG + Intergenic
1089622401 11:119729332-119729354 CGCCTCTGCTTCGGTCGGGAAGG - Intergenic
1092071762 12:5637053-5637075 CCCCTCTTCTGCTGCAGGGTGGG + Intronic
1098929609 12:76396320-76396342 CCTTTTTTCTTGGGCGGGGAGGG - Intronic
1101023041 12:100573147-100573169 CCCCTCTTCTCAGGTGCGGAGGG - Intergenic
1113439173 13:110314602-110314624 GGCCTCTTCTTCGCTGGGGAGGG + Intronic
1113913623 13:113856829-113856851 CCTCTCTGCTTCTGCAGGGACGG + Intronic
1114682920 14:24502009-24502031 CCCCTCTGCTTTGGAGGGGATGG + Intronic
1122930528 14:104931294-104931316 CCCCACTTGCTCTGCGGGGAAGG + Intronic
1124497598 15:30195988-30196010 CCCCTCATCTCCGGCGGGAAGGG - Intergenic
1124745991 15:32342703-32342725 CCCCTCATCTCCGGCGGGAAGGG + Intergenic
1125300827 15:38252448-38252470 CCGCTCTTCTCCGGCCGGGTGGG + Exonic
1129257305 15:74340947-74340969 CCTTCCTTCTTAGGCGGGGAAGG - Intronic
1129483178 15:75843641-75843663 CCCCTCATCTCCGGCGGGAGGGG - Exonic
1132301823 15:100780762-100780784 CCTCTCTTCTGTGGAGGGGATGG - Intergenic
1136367742 16:29816639-29816661 CCCCTCTGCCTCGGCCGGTAAGG + Exonic
1141694758 16:85614088-85614110 GCCATCTTCTGCGGGGGGGAGGG - Intronic
1142488040 17:259501-259523 CCACTATTCCTGGGCGGGGAGGG - Intronic
1145010078 17:19362924-19362946 CCTCTGCGCTTCGGCGGGGACGG - Intronic
1146950453 17:36901726-36901748 CCCCTCTTCTGCAGCGAGGCTGG + Intergenic
1147315675 17:39618990-39619012 CCCCTCTTCTCCCAAGGGGAAGG + Intergenic
1147620729 17:41865060-41865082 ACCCTGTGCTTCGGCGGGGCTGG - Exonic
1151724003 17:75874404-75874426 GCCCTCTCCTTCGTCTGGGAAGG - Exonic
1151945847 17:77319488-77319510 CCTCTCTGCCTGGGCGGGGACGG + Intronic
1160898699 19:1415866-1415888 GCCCCGTTCTTCGGTGGGGAGGG - Intronic
1161297256 19:3526354-3526376 CCCTTCTTCTCAGGCGTGGAGGG - Exonic
1161513197 19:4683057-4683079 GCCCTCTGCGGCGGCGGGGAGGG - Intronic
1162721184 19:12663896-12663918 CCCCTCTGCTTGGGAGGGGCAGG + Intronic
1163032653 19:14554405-14554427 CCCCTCTTCTGGGGCTGAGAGGG + Intronic
1166379661 19:42349387-42349409 GCCCTCTTCTTAGGAGGGGGTGG + Intronic
944490870 2:200256486-200256508 CCCCTCGTCTTCTGGGGGGCTGG - Intergenic
948789039 2:240367816-240367838 CGCCTCTTCTTACGCAGGGAGGG + Intergenic
949044810 2:241867502-241867524 CCCCTCTTCTTCGGCGGGGATGG - Intergenic
1172188594 20:33048145-33048167 CACCTCCTCTTCGACGTGGATGG - Intergenic
1173753652 20:45496322-45496344 ACACTCTTCTTGGGCAGGGAAGG + Intergenic
1176556574 21:8256683-8256705 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
1176575513 21:8439725-8439747 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
1183381856 22:37494175-37494197 GCTCTCTTCTTCAGCTGGGAGGG + Exonic
1183665413 22:39243578-39243600 CCCCTCTCCCCCGGCCGGGAAGG + Intronic
1203253563 22_KI270733v1_random:128780-128802 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
1203261618 22_KI270733v1_random:173858-173880 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
952604260 3:35125176-35125198 CCCCTCTTCTTCCATGGGGATGG - Intergenic
963123777 3:141797232-141797254 CGCCACTTCCTGGGCGGGGAGGG - Intronic
968008984 3:195260650-195260672 CCCGTCTTTTTCGGAGGGGTCGG - Intronic
968481330 4:834416-834438 CCCCTCTGCTTGGCCGGGGGCGG + Intergenic
968610991 4:1556882-1556904 CCCCTCCTCTTCTCCGGGGCGGG + Intergenic
969426658 4:7128387-7128409 CCCCTCTTCTGTGGCGGGTCAGG + Intergenic
978777078 4:112515350-112515372 CTCCTCTTCTTCGTCGGCGCTGG + Exonic
981429825 4:144645975-144645997 CCTCCCTGCTGCGGCGGGGAGGG - Intergenic
994321659 5:98401681-98401703 CCCCTCTCCATAGGCAGGGAAGG + Intergenic
998956486 5:147443957-147443979 CCCCTCTTCTGCAAGGGGGATGG - Intronic
1005040356 6:21595241-21595263 CCCCGCCTGTTCGGCGGCGAAGG - Exonic
1007414478 6:41683803-41683825 CCCCTCGTCTTCCCCGGGCAGGG + Intergenic
1018441377 6:163816611-163816633 CTTCTCTTCTGGGGCGGGGAGGG + Intergenic
1027005462 7:74689151-74689173 CTCCTCATCTTCAACGGGGAGGG - Exonic
1029448632 7:100628264-100628286 CTCCTCTTCATCAGCTGGGACGG - Exonic
1031975676 7:128092099-128092121 TCCCTCTTCCTCTGCCGGGAGGG + Exonic
1032804931 7:135343864-135343886 CTCCTCTTCTTAGGTGAGGATGG - Intergenic
1037754993 8:21704893-21704915 CCCATCTCCTTCCGTGGGGATGG - Intronic
1040520622 8:48173075-48173097 TCCCTCTTCTTTGTCGGGGAGGG + Intergenic
1042723034 8:71844469-71844491 CCCCTCTTCTTTGCCCGGGGTGG - Intronic
1049707644 8:144050288-144050310 CCCGTCTTCTGCGTGGGGGAGGG - Intergenic
1060528300 9:124332897-124332919 CCCCTCCTCTTGGTGGGGGACGG - Intronic
1061451228 9:130667877-130667899 ACCCTCTTCTTCTGGGGGTAGGG + Intronic
1203469964 Un_GL000220v1:111927-111949 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
1203477785 Un_GL000220v1:155899-155921 CCTCTCCTCTTGGGCGGGGGGGG + Intergenic
1185641971 X:1593380-1593402 CCCCTCCTCATTGGCGGGGGAGG + Intronic
1186160191 X:6769345-6769367 CTCCTCACCTTTGGCGGGGAAGG + Intergenic
1196384566 X:115135241-115135263 CCCCTCTACTTGGTCGGGGGTGG - Intronic