ID: 949044813

View in Genome Browser
Species Human (GRCh38)
Location 2:241867506-241867528
Sequence GCACCCCCTCTTCTTCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949044813_949044820 1 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044820 2:241867530-241867552 CATGGCTGGCTGATTTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 266
949044813_949044822 3 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044822 2:241867532-241867554 TGGCTGGCTGATTTGTGAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 201
949044813_949044819 0 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044819 2:241867529-241867551 TCATGGCTGGCTGATTTGTGAGG 0: 1
1: 0
2: 2
3: 18
4: 273
949044813_949044823 25 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044823 2:241867554-241867576 GCCACGTAAGCAGCTCTTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 73
949044813_949044821 2 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044821 2:241867531-241867553 ATGGCTGGCTGATTTGTGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 178
949044813_949044825 26 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949044813 Original CRISPR GCACCCCCTCTTCTTCGGCG GGG (reversed) Intergenic
901045268 1:6392535-6392557 GCACCCCCTCTTCTTCCACCAGG - Intronic
914504978 1:148281097-148281119 GCACCTCCTCTGCTTCTGTGGGG - Intergenic
914507586 1:148303051-148303073 GCACCTCCTCTGCTTCTGTGGGG + Intergenic
924842736 1:247730790-247730812 TCACACCCTCTTCTTGGGCTGGG - Intergenic
1066289178 10:33998433-33998455 GCACACTCTCTGCTTCGGCTGGG + Intergenic
1072190557 10:93073709-93073731 GCGCCGCCTCTGCCTCGGCGCGG + Intronic
1073345132 10:102777182-102777204 CCACCCCCTCTTCGTCTGAGAGG + Intronic
1074364262 10:112845440-112845462 GCAGCCCCTCTTCCTTGGTGGGG - Intergenic
1088710589 11:112504654-112504676 GCACCCTTTCCTCTTCAGCGTGG - Intergenic
1105992423 13:25635939-25635961 GCACCCCCTCCTGTTCTGCGGGG + Intronic
1106799647 13:33243144-33243166 GCACCTCCTCTTCTTCCTCATGG + Intronic
1112692927 13:101916741-101916763 GCACCCCCTCCTCTGCCCCGAGG - Intronic
1114499146 14:23155188-23155210 GCACCTCCTCTCCTTTGGAGGGG - Intronic
1117974117 14:61281021-61281043 GCTGCCGCTCTTCTTCTGCGCGG - Exonic
1118607491 14:67514711-67514733 ACACCTCCTCTTCTTCCGGGCGG - Intronic
1120474155 14:84966508-84966530 GCACCCCCTATTCTTCTGTTTGG - Intergenic
1124962590 15:34409814-34409836 GCACTCCTGCTTCTTGGGCGTGG - Intronic
1124979215 15:34556036-34556058 GCACTCCTGCTTCTTGGGCGTGG - Intronic
1131845651 15:96488002-96488024 GCTCCCCTTCTTCTTCAGCAAGG - Intergenic
1132856566 16:2047714-2047736 GCAGCCTCTCTTCTCCGGAGAGG + Exonic
1136576662 16:31129329-31129351 GCACCCCCACATCTCCAGCGGGG - Intronic
1138611675 16:58129709-58129731 GCAGCCCCTGTTCTCCCGCGCGG - Intergenic
1142130326 16:88429144-88429166 TCAGCCCCTGTTCTTCGGGGTGG + Exonic
1145802324 17:27696015-27696037 CCTCCCCCTCTTCTTCTGGGTGG + Intergenic
1148331968 17:46818626-46818648 GCTCCCCCTCTTCATGGTCGCGG - Exonic
1160577374 18:79864273-79864295 TCACCCGCTCCTCCTCGGCGCGG - Exonic
1161971683 19:7585003-7585025 GCACCCCCTCCTCTCCAGTGTGG - Intergenic
1165340451 19:35207857-35207879 CTACCCCCTCTTCTTCAACGTGG - Intergenic
1166045770 19:40229868-40229890 GAACCCCCACTTCTTAGGCGTGG - Intergenic
931748449 2:65310590-65310612 ACACCCCCTCTTCCTAGGCCTGG - Intergenic
932046249 2:68352868-68352890 TCACCCCCTCTTCTTGGGTCAGG - Intergenic
949044813 2:241867506-241867528 GCACCCCCTCTTCTTCGGCGGGG - Intergenic
1168732978 20:103503-103525 GCTCCCCATCTTCTTCTGAGAGG + Intergenic
1171172794 20:23030737-23030759 CCACCGCCTCTTCTTCCTCGTGG - Intergenic
1173262821 20:41451756-41451778 TCATCCCCTCTTCCTCTGCGGGG - Intronic
1174362479 20:50037678-50037700 ACAGCCCATCTTCTTCTGCGGGG + Intergenic
1176234150 20:64046473-64046495 GCACCCCCTCTGCATAGGTGGGG - Intronic
1179550392 21:42140175-42140197 CCACCCCCTCTTCGTCGGGCAGG - Intronic
1180614997 22:17121025-17121047 GCAGCCCCTCTTCCTCCGCGGGG - Exonic
1181512941 22:23396855-23396877 CCACCCCCTCTTCTGAGGCCTGG + Intergenic
1184755785 22:46515047-46515069 GCACCCCCTCAGCTTCAGCCTGG + Intronic
952604262 3:35125180-35125202 GCATCCCCTCTTCTTCCATGGGG - Intergenic
985688114 5:1292887-1292909 GAACCCCCTCTTCCTGGGGGTGG - Intronic
988264803 5:28934196-28934218 GCAACCCCTCTCCTCCGGGGCGG - Intergenic
998162505 5:139821575-139821597 GCACCTGCTCTTCTTCAGGGTGG - Intronic
1003162990 6:3651875-3651897 GCACCCCTTCCTCTTTGGGGTGG - Intergenic
1006025633 6:31145068-31145090 GCACCCCCTCCTTTTAGGGGAGG - Exonic
1013774063 6:113659423-113659445 TCACCCCCTCTTCTTCCCCATGG + Intergenic
1017962580 6:159234166-159234188 GCTCCCTCTCTTCCTTGGCGAGG - Exonic
1019343982 7:520770-520792 GCACCCGCCCTTTCTCGGCGTGG - Intergenic
1019442069 7:1052519-1052541 GCTCCCCCACTTCTTCCGCCAGG - Intronic
1021668600 7:23013441-23013463 TCGCGCCCTCTACTTCGGCGAGG - Intronic
1029693453 7:102197775-102197797 ACACGCCCTCTTCTGCGGGGTGG - Intronic
1035272237 7:157727289-157727311 GCACCCCCTCCTCTTAGGGCTGG - Intronic
1039891482 8:41688588-41688610 GCACCCTTTCTTCTTCTGCAGGG - Exonic
1044896461 8:96897897-96897919 ACACCTCCTCTTCTTCGGCATGG - Intronic
1057297978 9:93860528-93860550 GCACCCATTCTTCCTCAGCGTGG - Intergenic
1058686981 9:107488435-107488457 GCATCACCTCTTCTTCGACCCGG - Intronic
1060897274 9:127225641-127225663 GCACGCCCGCGGCTTCGGCGGGG + Intronic
1187588852 X:20693524-20693546 GCTCAGCCTCTTCTTGGGCGGGG - Intergenic