ID: 949044825

View in Genome Browser
Species Human (GRCh38)
Location 2:241867555-241867577
Sequence CCACGTAAGCAGCTCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949044815_949044825 24 Left 949044815 2:241867508-241867530 CCGCCGAAGAAGAGGGGGTGCTC 0: 1
1: 0
2: 1
3: 7
4: 76
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96
949044816_949044825 21 Left 949044816 2:241867511-241867533 CCGAAGAAGAGGGGGTGCTCATG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96
949044810_949044825 30 Left 949044810 2:241867502-241867524 CCATCCCCGCCGAAGAAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96
949044814_949044825 25 Left 949044814 2:241867507-241867529 CCCGCCGAAGAAGAGGGGGTGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96
949044813_949044825 26 Left 949044813 2:241867506-241867528 CCCCGCCGAAGAAGAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949044825 Original CRISPR CCACGTAAGCAGCTCTTGCA GGG Intergenic
901213572 1:7540442-7540464 CCAGGAAAGCAGCTCCTGCTGGG + Intronic
909315246 1:74209434-74209456 TCACGTAGACAGCTCTTCCAGGG - Intronic
916561902 1:165940772-165940794 CCACCTGAGCAGCTTTAGCAGGG + Intergenic
919610000 1:199733445-199733467 CCATGTAAGCAGATTTTCCAGGG - Intergenic
922716223 1:227874131-227874153 CCTCTTCAGAAGCTCTTGCAAGG - Intergenic
1073991375 10:109265981-109266003 CCACACAAGGAGCTATTGCAAGG + Intergenic
1075287738 10:121201794-121201816 CCAGGTAGGCAGCTCTGGGAAGG - Intergenic
1080299868 11:30772024-30772046 AAACGTAAACAGCTCTTTCAAGG - Intergenic
1084706565 11:70819385-70819407 CCACGAAAGCTGCACCTGCAGGG - Intronic
1087668790 11:101081734-101081756 CCATGTAAGGATCTCTTGTAAGG - Intronic
1093631794 12:21419158-21419180 CCAAGTAAGCTGCTCTTTCCTGG - Intronic
1094090600 12:26644950-26644972 CCCCGTAGGCAGCTCTGGAATGG - Intronic
1097586680 12:61523775-61523797 CCAAGTATGCAGCTACTGCAAGG + Intergenic
1101312651 12:103597275-103597297 CCACGTCAGCAGCTCTGAAATGG - Intronic
1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG + Intergenic
1105505866 13:21009243-21009265 CCACGTGGTCAGCTCTTGGAAGG + Intronic
1109462884 13:62686933-62686955 CCACCTAATCAGCTCTGGCATGG + Intergenic
1112479434 13:99760457-99760479 GCACCTAAGCATTTCTTGCAGGG + Intronic
1113082371 13:106533433-106533455 CCATGTAGTCTGCTCTTGCATGG - Intronic
1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG + Exonic
1120588296 14:86344243-86344265 CTCCCTAAGCATCTCTTGCAAGG + Intergenic
1125019841 15:34973614-34973636 CCACCGAAGCAGGTCATGCAGGG + Intergenic
1127327169 15:57906973-57906995 CCAGGTAAGAAGCTCCTGGAAGG - Intergenic
1128716597 15:69913257-69913279 GCAGATAAGCAGCCCTTGCATGG - Intergenic
1130536715 15:84790669-84790691 CCAAGAAAGCAGATCATGCAGGG - Intronic
1130750402 15:86705477-86705499 CCACGTAAAGTGTTCTTGCATGG + Intronic
1137590452 16:49690161-49690183 CCACTGAAGCCTCTCTTGCATGG - Intronic
1137691726 16:50432839-50432861 CCACACAAGCAGCTCATGCCCGG - Intergenic
1140432574 16:74917155-74917177 CCACCAAAGCAGCTCATGCCAGG + Intronic
1142959506 17:3543691-3543713 CCCCGTAGGCAGCTCTGGCGGGG - Intronic
1147731059 17:42602518-42602540 CCACTTAAGAAGCTTTTCCAGGG - Intronic
1154439276 18:14373231-14373253 TCACTGAAGCAGCTCTTGCTGGG - Intergenic
1155079202 18:22390901-22390923 ACACCGAAGCAGCTCTTACAAGG - Intergenic
1156336773 18:36179593-36179615 CCACAAAGGCTGCTCTTGCAGGG + Intronic
1160933530 19:1582231-1582253 CAAAGAATGCAGCTCTTGCATGG - Intronic
1163708949 19:18833808-18833830 CCACGTAAGCCCCCCATGCAAGG - Intronic
1164247405 19:23444206-23444228 CCACGTGAGGAGATCTTTCATGG - Intergenic
1165136957 19:33675582-33675604 CCAGGAAACCAGCTCTTGCGTGG - Intronic
1167850421 19:52197052-52197074 CCAAGTTAGGAGCTCCTGCATGG - Intronic
927449019 2:23190623-23190645 ACACGAAAGCAGCACATGCATGG - Intergenic
928499841 2:31879198-31879220 CCACTGAAACTGCTCTTGCAAGG + Intronic
928946805 2:36778971-36778993 CCATGTTTGCAGCTCTTGCTTGG + Intronic
931679083 2:64728263-64728285 GCACGTAAGCTACTCATGCAGGG - Intronic
931860065 2:66345738-66345760 CCACTTAAGCCCCTCTTCCATGG + Intergenic
932440019 2:71728752-71728774 TCACCTAAGCTGCACTTGCAGGG - Intergenic
932916346 2:75862757-75862779 CCACGTACTCAGGTTTTGCAAGG - Intergenic
938119123 2:128621455-128621477 CCACCTCAACAGCTCATGCATGG + Intergenic
943537621 2:189172061-189172083 CCACTTAAGCTGGTCTAGCATGG - Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1172948695 20:38707990-38708012 ACACCTAAGGATCTCTTGCAGGG - Intergenic
1173294596 20:41745623-41745645 CCACTTAAGGATCTCTTGTAAGG + Intergenic
1176088393 20:63308294-63308316 CCACATTAGCAGCTCTGGCTGGG + Intronic
1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1176834580 21:13781237-13781259 TCACTGAAGCAGCTCTTGCTGGG + Intergenic
1179013452 21:37574443-37574465 CCATGCAAGCAGCCCTGGCAAGG + Intergenic
949560344 3:5195775-5195797 CCACGTTGGCAGCTCAGGCATGG - Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
951054354 3:18129874-18129896 CAATTTAAGAAGCTCTTGCAAGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
956043512 3:65171194-65171216 CCACTTAGGTAGGTCTTGCATGG - Intergenic
957602490 3:82356127-82356149 CCAAGTAAGCAGGCCTTGGAGGG - Intergenic
959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG + Intergenic
964704075 3:159599876-159599898 CTCCTTAAGCAGTTCTTGCAGGG + Intronic
970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG + Intergenic
975223515 4:71841718-71841740 CCACCAAAACAGCTCTTACAAGG - Intergenic
975445818 4:74463930-74463952 CTAGGGAAGCAGCTCTTTCAGGG + Intergenic
978754881 4:112291171-112291193 CTTCGTAGGCAGCTCCTGCATGG - Intronic
980688685 4:136262717-136262739 TCCCTTAAGCATCTCTTGCATGG - Intergenic
981888602 4:149709819-149709841 CCACAGAAGCTGCTCCTGCAAGG + Intergenic
983660800 4:170129060-170129082 CCACATAAGCTGCTTTTCCATGG + Intergenic
984338281 4:178419840-178419862 CCACATAAACAGCACTTGCTCGG - Intergenic
984663898 4:182405035-182405057 CCAGGTAAGAAGCTAGTGCAAGG - Intronic
985010590 4:185578716-185578738 CCATGGAAGCAGCCCTTGCAAGG + Intergenic
997674215 5:135700780-135700802 CCATGTCTGCAGCTCTAGCAGGG + Intergenic
998443572 5:142181428-142181450 CCCCGCAAGCAGCCCTGGCAGGG - Intergenic
1003505398 6:6736378-6736400 CCACGTCACCATCACTTGCATGG + Intergenic
1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG + Intronic
1010877913 6:81131217-81131239 CCACGTAGTCAGGTATTGCAAGG - Intergenic
1010958361 6:82117346-82117368 CTATGTAGGCAGCTATTGCAAGG + Intergenic
1027168540 7:75853456-75853478 CCAGGTAAGGAGCTTTGGCAAGG - Intronic
1029223944 7:99011601-99011623 GCACATCAGCAGCTCCTGCAAGG - Intronic
1030161918 7:106518011-106518033 CCACAGAAACAGCTTTTGCAAGG + Intergenic
1035254120 7:157615284-157615306 CCACGCACACCGCTCTTGCAGGG - Intronic
1036477659 8:9108195-9108217 CCAAGGAGGCAGCTCTAGCAGGG + Intronic
1041136537 8:54765113-54765135 CCACGGAAGAATCTCATGCATGG - Intergenic
1042657480 8:71115722-71115744 CCACTCAAGCAGCCCTTGAAAGG - Intergenic
1042713846 8:71749864-71749886 CCACTTAAGAAGCTCTTACTGGG - Intergenic
1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG + Intergenic
1049451950 8:142666704-142666726 CCACCTGAGCAGCACGTGCAGGG - Intronic
1050487805 9:6153015-6153037 AGACGTAAGCATTTCTTGCACGG - Intergenic
1056431908 9:86536062-86536084 CCAACAACGCAGCTCTTGCATGG - Intergenic
1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG + Intronic
1061950218 9:133931894-133931916 CCACCTAAGCAACTGGTGCACGG - Intronic
1186121217 X:6363260-6363282 CCATTTAAGTAGCTCCTGCATGG - Intergenic
1186637527 X:11422424-11422446 CCATGTAAGGAGCACTTGGAAGG + Intronic
1188555648 X:31409287-31409309 CCATGTGAGCAGCTCTAGGATGG - Intronic
1193776118 X:85643923-85643945 TCCCTTAAGGAGCTCTTGCAAGG - Intergenic
1196770573 X:119289516-119289538 CCACGTAAGCTGCTTTTGTCAGG - Intergenic
1199256761 X:145726309-145726331 CCTTGTAAGCAGCACTTGTACGG + Intergenic