ID: 949046338

View in Genome Browser
Species Human (GRCh38)
Location 2:241874177-241874199
Sequence CCTCTCATCCAGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 218}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046324_949046338 16 Left 949046324 2:241874138-241874160 CCCTCCAGCCTCAGTGTAGCCTC 0: 1
1: 0
2: 2
3: 34
4: 622
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046322_949046338 23 Left 949046322 2:241874131-241874153 CCCTCTTCCCTCCAGCCTCAGTG 0: 1
1: 0
2: 8
3: 117
4: 966
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046332_949046338 -3 Left 949046332 2:241874157-241874179 CCTCTGGAGGGATCTTGGCACCT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046325_949046338 15 Left 949046325 2:241874139-241874161 CCTCCAGCCTCAGTGTAGCCTCT 0: 1
1: 0
2: 1
3: 32
4: 372
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046320_949046338 27 Left 949046320 2:241874127-241874149 CCCTCCCTCTTCCCTCCAGCCTC 0: 1
1: 3
2: 42
3: 399
4: 3214
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046323_949046338 22 Left 949046323 2:241874132-241874154 CCTCTTCCCTCCAGCCTCAGTGT 0: 1
1: 0
2: 27
3: 795
4: 11222
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046327_949046338 12 Left 949046327 2:241874142-241874164 CCAGCCTCAGTGTAGCCTCTGGA 0: 1
1: 0
2: 2
3: 30
4: 272
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046330_949046338 8 Left 949046330 2:241874146-241874168 CCTCAGTGTAGCCTCTGGAGGGA 0: 1
1: 0
2: 3
3: 38
4: 213
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218
949046321_949046338 26 Left 949046321 2:241874128-241874150 CCTCCCTCTTCCCTCCAGCCTCA 0: 1
1: 0
2: 19
3: 215
4: 1884
Right 949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046338 Original CRISPR CCTCTCATCCAGAGGGTGGG AGG Intergenic
901142383 1:7043533-7043555 ATTCTCATCCAGAGGCTCGGCGG + Intronic
901265353 1:7905973-7905995 CTTCACAGCCAGTGGGTGGGTGG + Intergenic
901523261 1:9802020-9802042 CCTCTCACAGAGTGGGTGGGGGG - Intronic
901591520 1:10347918-10347940 TCTCTATTTCAGAGGGTGGGCGG + Intronic
901643971 1:10706825-10706847 CATCTCATCCAGATGATGAGAGG + Intronic
901788293 1:11639082-11639104 CCTATGATTGAGAGGGTGGGAGG - Intergenic
902478226 1:16699162-16699184 CCACACAGCTAGAGGGTGGGAGG + Intergenic
902587097 1:17446446-17446468 CTTCTCTTCCTGAGGGTTGGAGG + Intergenic
902884240 1:19393461-19393483 TTTCTCATCCACAGGTTGGGGGG - Intronic
903458702 1:23506132-23506154 CCACTGATGTAGAGGGTGGGAGG + Intergenic
903833779 1:26189955-26189977 GCTCTTGGCCAGAGGGTGGGTGG + Intergenic
904299082 1:29542576-29542598 CCTCCCCTCCTCAGGGTGGGAGG - Intergenic
904323668 1:29713030-29713052 CCTCTCCGCCAGAGTGTGGCAGG + Intergenic
904964947 1:34364647-34364669 CTTCACATCAAGGGGGTGGGAGG + Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
909756459 1:79231744-79231766 CCTCTCATACAGAGAGGAGGGGG - Intergenic
913990622 1:143608377-143608399 CCACTCATCCAGAGTGAGGAGGG + Intergenic
915601510 1:156925492-156925514 CCTCACATCCATAAAGTGGGTGG - Intronic
915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG + Exonic
918308745 1:183270441-183270463 CCTTTCCTCCAGAGAGTGGCAGG - Intronic
919795005 1:201316365-201316387 CCTCTCCTCCAGAGGAGGGAAGG - Intronic
920174006 1:204088947-204088969 CCAGTGGTCCAGAGGGTGGGAGG + Intronic
920317517 1:205088659-205088681 CCTCCCACCCAGGAGGTGGGAGG - Exonic
923676977 1:236088628-236088650 CCTGGCATCCAGAGCCTGGGTGG + Intergenic
1063585779 10:7350916-7350938 CCACAGATCCAGAGGGTGTGTGG - Intronic
1063944393 10:11162961-11162983 CCTCTCATCTAGAGGCAGTGTGG - Intronic
1065283978 10:24169382-24169404 GGTCTTATTCAGAGGGTGGGTGG - Intronic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067208311 10:44238339-44238361 CCCCTCATCTATATGGTGGGTGG + Intergenic
1070883677 10:79871167-79871189 CCTGTCACCCACAGGGAGGGAGG + Intergenic
1071650236 10:87387477-87387499 CCTGTCACCCACAGGGAGGGAGG + Intergenic
1072533604 10:96342606-96342628 ATTCTCATCAAGATGGTGGGAGG + Intergenic
1075090959 10:119444018-119444040 CCTCACATCCAGCCTGTGGGGGG + Intronic
1075771819 10:124944907-124944929 CCCCTCATCCTCAGGATGGGAGG - Intronic
1075771820 10:124944907-124944929 CCTCCCATCCTGAGGATGAGGGG + Intronic
1076364285 10:129911821-129911843 CCTCTCACCCACAGGGAGGCCGG + Intronic
1077278596 11:1730556-1730578 CCTCTCATCCTGAGGTTCAGTGG + Intergenic
1077287421 11:1773785-1773807 CCCCTAATCCAGAGGGTTTGTGG - Intergenic
1077321246 11:1943200-1943222 TCATTCATACAGAGGGTGGGGGG - Intergenic
1077321286 11:1943406-1943428 TCATTCATACAGAGGGTGGGGGG - Intergenic
1077411942 11:2407730-2407752 TCTCTCCTCCAGGGGTTGGGTGG + Intronic
1079020123 11:16903400-16903422 CCCCTCATCCAGAGGGTCCCAGG + Intronic
1079022530 11:16921407-16921429 CCCCTCATCCATAGGGTCTGTGG - Intronic
1079526130 11:21390484-21390506 CCGCTCATCCACAGTGTGTGTGG + Intronic
1080456523 11:32424578-32424600 CCTCTCATATACAAGGTGGGTGG - Intronic
1083282566 11:61636282-61636304 CTTCTCATCGAGGGGGTGGGCGG - Intergenic
1083696732 11:64448529-64448551 CCTGTCACCCAGAGGGGGAGGGG - Intergenic
1083792471 11:64994758-64994780 CCGCTCATGTGGAGGGTGGGAGG + Intronic
1083889685 11:65589659-65589681 CCACTCATACAGAGGGGAGGAGG - Intronic
1083947327 11:65931440-65931462 CCTGTCATCCAGGAAGTGGGAGG - Intergenic
1084390424 11:68872170-68872192 CCTCTCTTCCCGGGGGCGGGGGG + Intergenic
1084811863 11:71616872-71616894 CCTCATATCCAGAGGGCGAGAGG - Intergenic
1084956349 11:72693631-72693653 CCTCTCTTCCAGAGCCAGGGTGG - Intronic
1085720677 11:78909888-78909910 GCCTTTATCCAGAGGGTGGGGGG + Intronic
1086161053 11:83722543-83722565 CCTCACCTCCAGAGGCGGGGTGG + Intronic
1090657233 11:128855441-128855463 CCTGGCACCCAGAGGGTGTGAGG + Intronic
1094226348 12:28050622-28050644 CCCCACATCCCTAGGGTGGGAGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096512958 12:52141974-52141996 TCACTCAGCCAGAGGGTGTGGGG + Intergenic
1096536142 12:52276022-52276044 CATCTAATCCAAAGGGTAGGTGG - Intronic
1100655134 12:96635982-96636004 CCTCCCCTCCAGGAGGTGGGAGG + Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1102229333 12:111251743-111251765 CCCCTCAGCCAGAGCCTGGGTGG + Intronic
1102345937 12:112161549-112161571 CCTCTCAACCAGAGTCTCGGAGG + Exonic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1102626283 12:114237812-114237834 ACTCTCATTTGGAGGGTGGGTGG - Intergenic
1103186834 12:118965556-118965578 CCTCCAATCCAGGGTGTGGGTGG - Intergenic
1103473665 12:121202193-121202215 TCTCCCATTCAGTGGGTGGGAGG - Intergenic
1104550303 12:129750661-129750683 ACTCCCTACCAGAGGGTGGGAGG + Intronic
1104704373 12:130932401-130932423 CCTCTCCCCCTGAGGCTGGGAGG + Intergenic
1106509785 13:30402884-30402906 CATCCCATCCAGAAGGTGGGTGG + Intergenic
1108459656 13:50652490-50652512 CCTCTCATCCAGAGTGAGCTAGG + Intronic
1108648517 13:52453281-52453303 CATCTGATTCAGAAGGTGGGAGG - Intergenic
1109380433 13:61552122-61552144 GCTCTCATCCAAATGGTGAGTGG + Intergenic
1110595960 13:77320716-77320738 CATCCCATCCAGAGGTTGTGAGG - Intronic
1113787460 13:113010118-113010140 CCTCTCATGGTGCGGGTGGGGGG - Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1121015945 14:90549223-90549245 CTTCTCCTCCAGAGGGAGTGAGG + Intronic
1122784845 14:104158837-104158859 CCTCTCATCCTGATGGTGTAAGG + Intronic
1122931919 14:104937078-104937100 CCTCTGAGCCAGAGGCTGTGAGG - Exonic
1125883714 15:43213451-43213473 CCTCTCTGCCTGAGTGTGGGTGG - Intronic
1127900779 15:63339310-63339332 GCTCTCAACCAGAGGGTCGCAGG + Intronic
1129238751 15:74239599-74239621 CCTCTCATCCACTGGCTGTGTGG + Intronic
1129521050 15:76186500-76186522 CTTCACACCCAGAGGGTGTGGGG - Intronic
1129730148 15:77926172-77926194 CCACTCCTCCTGGGGGTGGGGGG + Intergenic
1131223212 15:90602355-90602377 ACTCTCATCCAGAGGCTGTGAGG - Exonic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1137226071 16:46510804-46510826 CCTCTCAGCAGGAGGATGGGAGG + Intergenic
1138342227 16:56297472-56297494 CATGTCATCCACCGGGTGGGTGG - Intronic
1138345940 16:56320230-56320252 CCAATCATCATGAGGGTGGGCGG + Intronic
1138453342 16:57106593-57106615 CTTCTCATCCTGAGGGTGTCAGG - Intronic
1140254310 16:73321783-73321805 CCTCTCCCCCAAAGGGTAGGCGG + Intergenic
1141644620 16:85360562-85360584 CCTCTCATCCGGCAGGCGGGCGG + Intergenic
1143885178 17:10059953-10059975 CCTTTCCCCCTGAGGGTGGGTGG + Intronic
1146933207 17:36792756-36792778 GGTCTCATCTCGAGGGTGGGAGG - Intergenic
1147626176 17:41901650-41901672 CCCCTCACCCTGAGTGTGGGTGG - Intronic
1148177596 17:45581161-45581183 ACTCACATCCGGGGGGTGGGGGG + Intergenic
1151775552 17:76198862-76198884 TGTGGCATCCAGAGGGTGGGAGG - Intronic
1152239720 17:79155012-79155034 CCAGGCATCCAAAGGGTGGGTGG + Intronic
1154036662 18:10809855-10809877 CCTCTCTTTCAGTGGGTGGTGGG + Intronic
1155292738 18:24357728-24357750 TATCTGATCCAGTGGGTGGGAGG + Intronic
1155540306 18:26863068-26863090 CCCCTAATCCAGAGTCTGGGGGG - Intronic
1159769913 18:72537644-72537666 CCTCCCAGCCACATGGTGGGGGG + Exonic
1160279189 18:77471285-77471307 CTTCTCGTGCAGAGGGAGGGTGG + Intergenic
1160337904 18:78059285-78059307 CCTCTCTCCCACAGGGTGGCTGG - Intergenic
1160342586 18:78102230-78102252 CTTCCCATCCACAGGGTTGGGGG + Intergenic
1160969069 19:1759442-1759464 CCCTTCATCCAGAGTTTGGGTGG - Intronic
1163049068 19:14667668-14667690 CATCACACCCAGGGGGTGGGGGG + Intronic
1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG + Intronic
1163365172 19:16871949-16871971 CCACTTATCCTGAGGGAGGGTGG + Intronic
1163559502 19:18010374-18010396 GCTTGCATGCAGAGGGTGGGTGG + Intronic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165728769 19:38130786-38130808 CCTTTCAGCCAGGTGGTGGGTGG + Intronic
1165769088 19:38368009-38368031 CATCTCAGCCAGGGGTTGGGGGG - Intronic
1167116457 19:47491878-47491900 CTTCTCATCCAAAGGCTGGCTGG + Intronic
1202712247 1_KI270714v1_random:24990-25012 CCACACAGCTAGAGGGTGGGAGG + Intergenic
925154071 2:1637026-1637048 CCGTTCATCCTGAGGGTGGAAGG + Intronic
925883186 2:8369888-8369910 CCTCCCACCCACAGCGTGGGAGG + Intergenic
926302068 2:11611702-11611724 CCCCTCTCCCAGATGGTGGGGGG + Intronic
929778197 2:44941553-44941575 CCACTTAGCCAGAGGGCGGGGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932199442 2:69812639-69812661 TTTCTCATCCTCAGGGTGGGAGG + Exonic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932621450 2:73266728-73266750 GCTCTCCTCCAGAGGGTGGGTGG - Intronic
932948739 2:76268350-76268372 CCTGTCATCCAGATGCTGTGAGG + Intergenic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
937225755 2:120367863-120367885 ACTCTCTTCCTGGGGGTGGGGGG + Intergenic
937251322 2:120525726-120525748 CCTCTCTCTCAGAGGGTAGGTGG - Intergenic
937424881 2:121790441-121790463 CCTCTCACCCTGAGTGTGGGTGG - Intergenic
940298932 2:152159274-152159296 CCTGTCACCCAGGGTGTGGGTGG - Intronic
944874311 2:203946052-203946074 ACTCTCTTCCACAGAGTGGGAGG - Intronic
945808116 2:214515378-214515400 CCTCTCCTCCACAGGGGTGGAGG - Intronic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
948272582 2:236686099-236686121 TCTCTCATTCAGAGGGCAGGAGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168869932 20:1119274-1119296 CCCCTCACCCCGAGGCTGGGTGG - Intronic
1169062598 20:2672495-2672517 CCTCTCACCCAAATGGTGGGTGG + Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169376263 20:5068911-5068933 CCTCTGTTCCTGAGGGTAGGAGG - Intronic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1170858096 20:20076177-20076199 CCTCTCTTCCTGAAGCTGGGTGG + Intronic
1171012843 20:21517856-21517878 CCTCTCAGCCTGCGGGTGTGCGG - Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1173624835 20:44465190-44465212 CCCCTCACCCACAGGGTGGCTGG - Exonic
1173867842 20:46323870-46323892 CCTCTGGCCCTGAGGGTGGGGGG + Intergenic
1175084848 20:56450007-56450029 CCTCTCAACCAAAGGTTGGGGGG - Intronic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175971192 20:62687572-62687594 CCTCTGAGCCAGAGAGGGGGAGG + Intergenic
1178684507 21:34700677-34700699 CCTCTCTTCGAGGGGGTGGTAGG + Intronic
1179131162 21:38638634-38638656 CCTCCCTGCCAGAGGATGGGGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181634717 22:24169245-24169267 CCTCCAAGCCAGAGGGTAGGTGG + Intronic
1181725918 22:24810820-24810842 CCCCTAACCCAGAGGCTGGGAGG - Intronic
1182135400 22:27897749-27897771 CCTCTCATTCTCAGGGTGGAGGG + Intronic
1183716875 22:39538262-39538284 CATCTCATCCACAGCTTGGGGGG + Intergenic
1184899330 22:47434543-47434565 ACTCTCAGCCAGAGGGTGAGTGG + Intergenic
1185374330 22:50475102-50475124 CCATTGGTCCAGAGGGTGGGAGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950673699 3:14541764-14541786 GGTCTCAGCCACAGGGTGGGTGG + Intronic
951873606 3:27395092-27395114 CTACTCATCCAGAGAGAGGGTGG - Exonic
953814798 3:46146182-46146204 CCTTTCATCTTGAGGGTGGCAGG + Intergenic
954110897 3:48432378-48432400 CCCCTCCTCCAGAGGGTCTGAGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
957077404 3:75612593-75612615 CCTCAAATCCAGGGGGTGTGAGG - Intergenic
960166706 3:114410846-114410868 CCTCTCCTCCAGAAAATGGGCGG - Intronic
960420099 3:117434861-117434883 GCACTCACCCAGAGGGTGGCTGG - Intergenic
961765282 3:129205675-129205697 CATCTCCTCCTGAGGGTGTGTGG - Intergenic
962038835 3:131683531-131683553 CCTCTCCTCAAGTGGGAGGGAGG + Intronic
962935459 3:140076551-140076573 CCTGTCAGCCAGAGTGTGGGAGG - Intronic
966843186 3:184105978-184106000 CTTCTCTTCCAAAAGGTGGGAGG - Intronic
967038124 3:185663340-185663362 CCTCTCAGTTAGTGGGTGGGAGG - Intronic
968150862 3:196335640-196335662 CCTGTCAGCCAGAGGGTTGATGG - Intronic
968909285 4:3469406-3469428 GCCCGCAGCCAGAGGGTGGGTGG + Intronic
969734563 4:8978324-8978346 CCTCGTATCCAGAGGGCGAGAGG - Intergenic
969841812 4:9888459-9888481 TCACTCATCCGGGGGGTGGGTGG + Intronic
975720696 4:77245990-77246012 CTTCCCATCCAGAGGGTGGTGGG + Intronic
981724123 4:147830011-147830033 CCTCTCATCCTGGGGGTGCTGGG + Intronic
982790426 4:159585729-159585751 CCTTTCTTCCAGGGGGAGGGAGG - Intergenic
983742387 4:171151571-171151593 CCTCTAATCCAGTGGGTAAGAGG + Intergenic
983953494 4:173670448-173670470 CTTCTCACACATAGGGTGGGTGG + Intergenic
985688110 5:1292883-1292905 CCCCTCTTCCTGGGGGTGGGAGG - Intronic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
986753346 5:10810794-10810816 CCTCTCTTTCAGAAGGTGTGGGG + Intergenic
990431170 5:55737074-55737096 GCTCTGATCCAGAAGGAGGGAGG - Intronic
993187346 5:84636440-84636462 CCTAACATCCATAGGGTGGGTGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
998133082 5:139660866-139660888 CCTCCCAGCCAGTGGGTGGGTGG - Intronic
999879688 5:155848122-155848144 CTTCTGTTCCAGAGGGAGGGAGG + Intergenic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1003414234 6:5893750-5893772 CCTCCCATCGAGAGTTTGGGTGG - Intergenic
1003809030 6:9759001-9759023 CCTCTCTCCTAGAGTGTGGGTGG + Intronic
1005925198 6:30438600-30438622 ACTCTCATCCAGTGAGTGAGAGG - Intergenic
1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG + Intergenic
1006788897 6:36686081-36686103 CCTCTCTCCCGGAGGTTGGGTGG + Exonic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1018123444 6:160659262-160659284 CCTCTTTTCCATAGGGTGGCTGG + Intronic
1019307766 7:344025-344047 CCTCTCTGCCAGTGGCTGGGGGG - Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1023756159 7:43418960-43418982 ACTGTCATCCATATGGTGGGAGG + Intronic
1023882039 7:44326115-44326137 CATCTCTTCCTGAGGGTGTGAGG - Intronic
1024128273 7:46323217-46323239 CTCCTAAGCCAGAGGGTGGGAGG + Intergenic
1026983904 7:74542814-74542836 ACTCACAGCCAGAGGCTGGGTGG + Intronic
1028621727 7:92834663-92834685 CCTCCCTTTCAAAGGGTGGGGGG + Intronic
1029077836 7:97950058-97950080 CCTCATATCCAGAGGGCGAGAGG + Intergenic
1029658391 7:101942762-101942784 CCTCTGACCCAGAGTCTGGGAGG - Intronic
1031134547 7:117872220-117872242 CCCTACCTCCAGAGGGTGGGAGG + Intronic
1032810656 7:135412730-135412752 CTTCTCATTTAGAAGGTGGGGGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034530088 7:151690201-151690223 CCACTCATCCCGAGGGAGGTGGG + Intronic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1037567653 8:20130905-20130927 CCCATCCTCCAGAGGCTGGGAGG - Intergenic
1037855207 8:22366973-22366995 ACTCTCCTCCAGGGGGTGTGGGG + Intergenic
1039398318 8:37246638-37246660 TCTCTCCTCCTGAGGCTGGGAGG - Intergenic
1042660104 8:71144985-71145007 CCTTTCTTCCAAGGGGTGGGGGG - Intergenic
1043218085 8:77621080-77621102 CCTGTCATCCAGTGGGTGTTGGG + Intergenic
1043635391 8:82377004-82377026 CCTAACATCCAGAGGGGGAGAGG + Intergenic
1043635594 8:82378132-82378154 CGTAACATCCAGAGGGTGAGGGG + Intergenic
1047104750 8:121720250-121720272 CCTCCCATCCAGAGGCTCGGGGG - Intergenic
1050552143 9:6758008-6758030 CCTCCCGTCGAGGGGGTGGGTGG - Intronic
1053097669 9:35342598-35342620 GCACACATCCAGAGGGTGGCTGG - Intronic
1056574672 9:87846526-87846548 CCTGTCACCCACAGGGAGGGAGG - Intergenic
1057723756 9:97554107-97554129 TCTCTGATCCAGGGAGTGGGTGG + Intronic
1057854847 9:98594282-98594304 GCTCTCAGCCACGGGGTGGGAGG - Intronic
1058857096 9:109073179-109073201 CATGTAATACAGAGGGTGGGAGG - Intronic
1060727462 9:126015943-126015965 CCTCTTTTCCACAGGATGGGCGG - Intergenic
1061483385 9:130908389-130908411 CCGCTGCTCCAGGGGGTGGGTGG + Intronic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1062060630 9:134493468-134493490 TCTCTCATCCACAGGATGGCGGG - Intergenic
1186478994 X:9881424-9881446 CATCTCACCGAGAGGGTGGCAGG - Intronic
1188475510 X:30587381-30587403 CCTCTGAGCCAGTGGATGGGAGG + Intergenic
1199741437 X:150739906-150739928 ACACAGATCCAGAGGGTGGGTGG - Intronic
1200162483 X:154016620-154016642 CCTCTCATCCAGAAGGACGTTGG + Exonic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic