ID: 949046523

View in Genome Browser
Species Human (GRCh38)
Location 2:241874862-241874884
Sequence CCCTGGATTGGGGTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 3, 1: 4, 2: 5, 3: 20, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046523_949046538 5 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046538 2:241874890-241874912 GGGGCCAACTGCAGGGACAGGGG 0: 1
1: 1
2: 7
3: 23
4: 338
949046523_949046542 29 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046542 2:241874914-241874936 CCCAGGAGAAACCCCAATCCAGG 0: 5
1: 5
2: 3
3: 38
4: 220
949046523_949046534 -2 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046534 2:241874883-241874905 GGCCTCGGGGGCCAACTGCAGGG 0: 2
1: 1
2: 3
3: 25
4: 163
949046523_949046536 3 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046536 2:241874888-241874910 CGGGGGCCAACTGCAGGGACAGG 0: 1
1: 0
2: 1
3: 15
4: 190
949046523_949046540 12 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046540 2:241874897-241874919 ACTGCAGGGACAGGGGTCCCAGG 0: 1
1: 1
2: 11
3: 41
4: 360
949046523_949046533 -3 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046533 2:241874882-241874904 GGGCCTCGGGGGCCAACTGCAGG 0: 2
1: 2
2: 1
3: 20
4: 200
949046523_949046537 4 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046537 2:241874889-241874911 GGGGGCCAACTGCAGGGACAGGG 0: 1
1: 1
2: 6
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046523 Original CRISPR CCCTGGATTGGGGTTTCTCC TGG (reversed) Intergenic
900657593 1:3767424-3767446 CCCTGGACTGGGAGCTCTCCAGG - Exonic
901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG + Intergenic
902621099 1:17651595-17651617 ACCTGGATGGGGGTTTCTTTTGG - Intronic
903539732 1:24090172-24090194 CCCTGGTGTGGGGTAGCTCCTGG - Intronic
905293057 1:36936243-36936265 CCCTGGGTTGGGATTCCTCCAGG - Intronic
905448067 1:38040303-38040325 GCCTGGATTGGGGTTTTAACTGG + Intergenic
905484926 1:38288867-38288889 CCCTGGAAAGGGGTTTCTAATGG + Intergenic
907281654 1:53350893-53350915 CCCAGGATTAAGGTTTCTCCTGG + Intergenic
907881067 1:58549741-58549763 CCCTGGAATGGGATTTCTGAAGG - Intergenic
907927043 1:58964834-58964856 TCCTGGATAGGGGCTTCTCTTGG - Intergenic
908418997 1:63941123-63941145 CCCTGGACTGGGTTTTGTGCTGG + Intronic
908571928 1:65420103-65420125 CACTGGGTTGGGGTTACTCTGGG + Intergenic
911544729 1:99202885-99202907 CCCTTTATTGTGGTTTCTGCTGG - Intergenic
913050243 1:115111161-115111183 CCGTGGACTGGGGTATCTGCAGG - Intergenic
917195266 1:172457598-172457620 ACTAGGATTGGGATTTCTCCTGG + Intronic
917205979 1:172571900-172571922 TCCAGGATTGGGGTGGCTCCCGG - Intronic
917736245 1:177923063-177923085 CCCAGGATAGTCGTTTCTCCAGG - Intergenic
918356419 1:183709502-183709524 TCCTAGATTGGGGTTCTTCCTGG + Intronic
919606379 1:199689431-199689453 GCCTTTATTGGGGTTTCTGCAGG - Intergenic
922798607 1:228353637-228353659 GCCTGGTTTGGGGCTGCTCCTGG + Intronic
924944520 1:248837720-248837742 CCAGGGATAGGGGTTACTCCTGG - Intergenic
1062913946 10:1233250-1233272 CCCTGCAAAGGGGTTTCCCCAGG - Intronic
1066177433 10:32923488-32923510 GACTGGCTTGGGGTTTCTCAGGG - Intronic
1066448676 10:35508477-35508499 CCCTGGATAGCCATTTCTCCAGG + Intronic
1073111879 10:101067376-101067398 CCCTGGAATGCGCTTTCTTCTGG + Intronic
1076627257 10:131829647-131829669 CCCTGGAGTGGGGCTGCCCCGGG - Intergenic
1076681148 10:132172006-132172028 CCCTGGGTTCTGGTTTCTCCAGG + Intronic
1078425654 11:11248714-11248736 CCCTGGATTAGGGTATCTATAGG + Intergenic
1084257697 11:67954404-67954426 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1084815068 11:71640833-71640855 CCCAGTCTTGGGGTTGCTCCTGG + Intergenic
1088941032 11:114456382-114456404 CCATGGATTTGGGTATCTGCAGG - Intergenic
1091595281 12:1874418-1874440 CCCTGGCTAGGTGTTTCTCCAGG + Intronic
1091624876 12:2114167-2114189 TCCTGACTTGGGGTCTCTCCTGG + Intronic
1092429204 12:8396213-8396235 CCCAGTCTTGGGGTTGCTCCCGG - Intergenic
1092693738 12:11144931-11144953 CACTGTATTTGGGTGTCTCCTGG + Intronic
1093557851 12:20498586-20498608 CCCTGGATTTTGGTGTCTACAGG + Intronic
1094456133 12:30635646-30635668 ACCTGGTTTGGGTTTACTCCAGG - Intronic
1097151503 12:56982916-56982938 TCCTGGATTGGGGAAGCTCCTGG - Intergenic
1097682122 12:62658658-62658680 TCCTGGAGTGGGGTTGCTGCAGG - Intronic
1100614698 12:96221973-96221995 CCCTGGGTTGCGGTCACTCCAGG + Intronic
1103780641 12:123396558-123396580 CTCTGGACTTGGTTTTCTCCTGG + Intronic
1108572770 13:51767415-51767437 CCCTGGATCAGAGTGTCTCCAGG + Exonic
1109776208 13:67044069-67044091 CCCTGGAATGGGGGTTGTCTTGG + Intronic
1116510794 14:45744039-45744061 CCCTTTATTGTGGTTTCTGCAGG - Intergenic
1116686614 14:48047924-48047946 TCCTTTATTGGGGTTTCTGCGGG + Intergenic
1116788870 14:49318495-49318517 CACTGCTTTGGGGTTTCTCCAGG + Intergenic
1118051877 14:62038115-62038137 ATGTGGATAGGGGTTTCTCCAGG + Intronic
1118051914 14:62038399-62038421 ACGTGGACAGGGGTTTCTCCAGG - Intronic
1118368729 14:65117798-65117820 CTGTGGTTTGGGGTTTCTCAGGG - Intergenic
1122364038 14:101183722-101183744 GCCTGGAGTGGGGTTGCTGCCGG - Intergenic
1122655939 14:103259286-103259308 TCCTGGAGTGGGGTGTCTACGGG + Intergenic
1125674036 15:41493364-41493386 CCCTGGGGTGGGGCTTCTTCGGG + Intergenic
1125711767 15:41792681-41792703 GCCTGGACTGGTGTGTCTCCTGG + Intronic
1126473514 15:49042475-49042497 CCCTGGAGTGGGGAAACTCCAGG - Intronic
1128100823 15:64998498-64998520 CACTGGATTGTGGTTTCTACAGG + Intergenic
1129068975 15:72935634-72935656 CCCTGGAAGGGGATTTCCCCTGG + Intergenic
1129243812 15:74267931-74267953 CCTGGGATTGGGGTTCCTCATGG - Intronic
1129568020 15:76645216-76645238 CCCTGGATTTTGGTATCTGCAGG + Intronic
1132572650 16:650761-650783 CCCTGGACTTGGGCCTCTCCAGG - Intronic
1133099437 16:3470280-3470302 GCCTGGCTTGGGGCTTCTCCAGG + Intronic
1133278221 16:4650643-4650665 CCCTGGAATGGGTTGTGTCCTGG + Intronic
1133327967 16:4953609-4953631 TCCTGGATTTGGGAATCTCCAGG - Intronic
1133370319 16:5241167-5241189 CCCAGTCTTGGGGTTGCTCCCGG + Intergenic
1134262455 16:12662974-12662996 TCCAGGATGGGGGTTCCTCCAGG - Exonic
1136658244 16:31727311-31727333 CCCCAGATTGGGGCTTATCCTGG + Intronic
1138950779 16:61909889-61909911 CACTGGCTTGGGAATTCTCCTGG - Intronic
1139952379 16:70678645-70678667 CGCTGGATTGGGGCATCTCCGGG + Intronic
1141235586 16:82212816-82212838 TCCTGGATTTGTGTTTATCCTGG + Intergenic
1143344858 17:6242102-6242124 CCCAGAATGGGGGCTTCTCCAGG - Intergenic
1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG + Intronic
1146244993 17:31272579-31272601 CCCAGGATTGGGGTTCATTCTGG + Intronic
1146823159 17:36000764-36000786 ACCTTTATTGGGGTTTCTCGGGG - Intronic
1147996299 17:44362174-44362196 GCCAGGATTGGGGGTTCTCTGGG - Intronic
1149027248 17:52041271-52041293 CCATTGATTGGTTTTTCTCCTGG - Intronic
1149472235 17:56926327-56926349 AACTGAATTGGGGTTTCTCTTGG + Intergenic
1150658041 17:67053416-67053438 CCCAGGTTTGGGGTTGATCCAGG + Intronic
1150985760 17:70195498-70195520 CCCTGGAACAGGGTTTCTCAAGG - Intergenic
1151730190 17:75906391-75906413 CCCAGGAGAGGGGTCTCTCCAGG + Intronic
1153257847 18:3190436-3190458 GCCAAGATTGGGGTTTCTCATGG + Intronic
1153504579 18:5782764-5782786 CCCTGGTTTGTAGTTTCACCAGG + Intergenic
1153617162 18:6945777-6945799 CCCTGCATGGGGGCTGCTCCTGG - Intronic
1155631269 18:27896230-27896252 CCCTGGATTTTGGTATCTTCAGG - Intergenic
1158703533 18:59770695-59770717 GCCTGGAGAGGGGTTTCTCAGGG - Intergenic
1160427793 18:78790302-78790324 TCCTGCATTGCGGTGTCTCCTGG - Intergenic
1161430478 19:4229447-4229469 CCCTGGGCTGGGCTTTCCCCTGG + Intergenic
1163629675 19:18411647-18411669 CTTTGCATTGGGTTTTCTCCTGG - Intergenic
1167004142 19:46764724-46764746 CCCCGGATTAGGGTTGGTCCTGG - Intronic
1167664439 19:50815718-50815740 CCCTGGATGAGGGATTCTCCTGG - Intergenic
1168583433 19:57574331-57574353 GCCTTTATTGGGGTTTCTGCAGG - Intronic
1202646992 1_KI270706v1_random:152401-152423 CGCTGGCTTGCGGGTTCTCCTGG + Intergenic
925947667 2:8880617-8880639 CCCTGGACTTCGTTTTCTCCAGG - Intronic
927029930 2:19110455-19110477 CACTGCATTGGGGTTGCTGCAGG + Intergenic
928201254 2:29249162-29249184 CCCTTGAATGGGGATTCTCTTGG - Intronic
928205139 2:29278599-29278621 CCCAGGCTTGGGCTTTGTCCAGG - Intronic
928280946 2:29945736-29945758 CCCAGAATTGGGGTTTAGCCAGG - Intergenic
928326549 2:30323840-30323862 CACAGCCTTGGGGTTTCTCCTGG + Intergenic
929545989 2:42855491-42855513 CCCTGGTGTGGGGATTATCCTGG + Intergenic
930416304 2:51094620-51094642 CTCTGGATTGTGGTTGCTCTAGG - Intergenic
931248337 2:60509364-60509386 CCCTGGCTTGGAATTTCTTCCGG - Intronic
935633102 2:105228109-105228131 TCCTGGATTGGGGTTTCCAAAGG + Intergenic
939683804 2:145172109-145172131 CCCTCACTTGGGGTTTCTCAAGG + Intergenic
941828411 2:169925981-169926003 GCCTTTATTGGGGTTTCTGCAGG + Intronic
942519754 2:176791073-176791095 CCCTGGACTGGGTTATCACCTGG - Intergenic
949046506 2:241874810-241874832 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046523 2:241874862-241874884 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046543 2:241874915-241874937 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046561 2:241874968-241874990 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046579 2:241875020-241875042 CCCTGGATTGGGGTTTCCCCTGG - Intergenic
949046596 2:241875072-241875094 GCCTGGATTCTGGTTTTTCCTGG - Intergenic
949046612 2:241875124-241875146 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046628 2:241875176-241875198 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046644 2:241875228-241875250 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046826 2:241876342-241876364 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046846 2:241876396-241876418 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046862 2:241876449-241876471 ACCTGGACTGAGGTTTCTCCTGG - Intergenic
949046879 2:241876502-241876524 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046895 2:241876553-241876575 ACCTGGATTGAGGTTTCTCCTGG - Intergenic
949046911 2:241876606-241876628 CCCTGGATTCCAGTTTCTCCTGG - Intergenic
949046929 2:241876660-241876682 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046948 2:241876713-241876735 CCCTGGACTCCAGTTTCTCCTGG - Intergenic
1168772381 20:423681-423703 CCATGGATTTGGGTATCTGCAGG + Intronic
1170058989 20:12239750-12239772 TCCAGGTATGGGGTTTCTCCTGG - Intergenic
1171877125 20:30586494-30586516 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1175318017 20:58065334-58065356 ATCTGGATTCAGGTTTCTCCTGG - Intergenic
1175695726 20:61101497-61101519 CCCTCACTTGGGGTCTCTCCAGG - Intergenic
1175695837 20:61102057-61102079 CCCTCACTTGGGGTCTCTCCAGG - Intergenic
1176604877 21:8820373-8820395 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1180347167 22:11711978-11712000 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1180354917 22:11830068-11830090 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1180383334 22:12162263-12162285 CGCTGGCTTGCGGGTTCTCCTGG + Intergenic
1181282485 22:21729708-21729730 CCCTGGATGGGGGTTCATCTGGG + Intronic
1181468912 22:23126244-23126266 CCCTGGAGGGAGGTTTCTCCCGG + Intronic
1181754892 22:25016793-25016815 CCCAGAATTGGGGCTTCACCTGG + Intronic
1181860755 22:25816197-25816219 GCCTGAATTGGATTTTCTCCCGG + Intronic
1181920241 22:26314982-26315004 CCCTGTATTCTGCTTTCTCCAGG - Intronic
1184765642 22:46570618-46570640 CCCTGCAGTGGCCTTTCTCCCGG + Intergenic
949544812 3:5063343-5063365 CCATGTCATGGGGTTTCTCCAGG - Intergenic
949865462 3:8543311-8543333 CCCAGGGTTGGGGCTTCTCTCGG - Intronic
950121318 3:10484139-10484161 CCCTGGCTTTGGGTTTCCCAAGG + Intronic
951382128 3:21996317-21996339 CCCTGCAGTGGAGTTTCTCCTGG + Intronic
951566783 3:24019457-24019479 CGCTGCATTGGGGAATCTCCAGG + Intergenic
951696163 3:25447682-25447704 GCCTGGATTGGGGATTGGCCAGG + Intronic
952213267 3:31250693-31250715 CCCTGGATTGGGCTGTTTCAGGG - Intergenic
956454806 3:69409959-69409981 GTCTGAAATGGGGTTTCTCCTGG + Intronic
960998829 3:123358687-123358709 CCCTCTAGTGGGGTCTCTCCTGG - Intronic
961718889 3:128879142-128879164 CGCTGTATTGGGGTCTCTGCAGG - Intergenic
963598988 3:147361011-147361033 GCCTGGAGTGGGGTTTCTCTTGG + Intergenic
968353347 3:198080791-198080813 CGCTGGCTTGCGGGTTCTCCTGG + Intergenic
968427826 4:534936-534958 CCCTTGATCTGGGTTTCCCCGGG - Intronic
968613602 4:1567762-1567784 CCCTGGGCTGGGGCTGCTCCTGG - Intergenic
968835946 4:2964155-2964177 CCCGGGATTCGGGGTTCTCTGGG - Intronic
968912083 4:3481464-3481486 CCCTGGACTGGGGCTGCTTCAGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969737719 4:9002121-9002143 CCCAGTCTTGGGGTTGCTCCCGG + Intergenic
969796922 4:9533682-9533704 CCCAGTCTTGGGGTTGCTCCCGG + Intergenic
970320259 4:14868158-14868180 CCCTGGAGAGGGGTTTCAGCTGG - Intergenic
970666388 4:18342364-18342386 CCCTGGGATGGGGTTTTTCTGGG + Intergenic
971732655 4:30406246-30406268 CCCTGTATTGGGGTTTCTCTTGG - Intergenic
972699959 4:41484263-41484285 CCCTGGACTGTGATTTCTACAGG + Intronic
973387760 4:49524644-49524666 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
973783956 4:54317932-54317954 GCCTGGACTGGGATTTCTGCAGG + Intergenic
974911816 4:68132337-68132359 CCCTGTATTGGGGAGTCTCTTGG - Intergenic
975412420 4:74069565-74069587 CACTGGGTTAGGGTCTCTCCAGG - Intergenic
975492405 4:75003168-75003190 CCCTGTATTGGGGTTTCTCAGGG - Intronic
978896224 4:113890784-113890806 CCCTGGCTTTGAGTCTCTCCAGG + Intergenic
979288187 4:118950441-118950463 GCCTGTATTGTGGTTTCTACAGG + Intronic
984661127 4:182376740-182376762 CCCTGAATTGGGGTTGTTTCTGG + Intronic
984818586 4:183860333-183860355 TCCTGGATTGGGGTTTTGGCTGG - Intronic
986632063 5:9783398-9783420 CTCTGGATGGGGCCTTCTCCAGG - Intergenic
989347077 5:40441065-40441087 CCCAGGAATATGGTTTCTCCTGG - Intergenic
992950900 5:81857230-81857252 CCCTGGGCTGTGGGTTCTCCAGG - Intergenic
996505850 5:124266895-124266917 CTCTGGACTAGGCTTTCTCCTGG + Intergenic
996783772 5:127216235-127216257 CCCTGGATTGCCTTATCTCCAGG - Intergenic
997471433 5:134119590-134119612 CCCTGGCTTGGGGCATCCCCAGG - Intronic
997519334 5:134512593-134512615 CCCAGGATTAGGGTCTCTCTGGG - Intergenic
997580060 5:135011581-135011603 CCAAGGACTGGGGCTTCTCCTGG - Exonic
997693404 5:135843189-135843211 CCCTGCATTGGGATGTCCCCTGG - Intronic
998632520 5:143915624-143915646 GCCTGGATTTGGGGTTCTTCTGG + Intergenic
1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG + Intronic
1002369611 5:178741201-178741223 CCCTGGATTGCTTTATCTCCAGG + Intergenic
1003316353 6:5015761-5015783 CCATGGAATGGGGTTGATCCAGG - Intergenic
1003383508 6:5646617-5646639 CCCTGGATTTTGGTATCTGCTGG - Intronic
1005026171 6:21465102-21465124 TCCTGGACTGCTGTTTCTCCAGG + Intergenic
1005137445 6:22586138-22586160 ACCTGGATTAGGGTTCCTTCAGG - Intergenic
1005375559 6:25178956-25178978 ACCTGGTTTGGCTTTTCTCCTGG + Intergenic
1006271490 6:32969835-32969857 CCAAGGTTTCGGGTTTCTCCAGG + Intronic
1009912314 6:69946033-69946055 CCCAGCTTTGGGGTTTTTCCTGG + Intronic
1010087866 6:71941808-71941830 CCCTGGATTGGTGTAGCACCTGG - Intronic
1010694179 6:78949551-78949573 TCCTTTATTGGGGTTTCTGCAGG - Intronic
1012505399 6:99940862-99940884 GCCTGGCTAGGGGTTTGTCCAGG + Intronic
1012945052 6:105456371-105456393 CCCAGTATAGGGTTTTCTCCAGG - Intergenic
1017962187 6:159232602-159232624 CCCTGAATGGGGGGTCCTCCGGG - Exonic
1018568961 6:165186701-165186723 CCCTGGGGTGGGGTTGCTGCAGG + Intergenic
1022497175 7:30860488-30860510 CCCAGGACTGGGTTTGCTCCTGG + Intronic
1022821934 7:33970617-33970639 TCCTGGCATGGGGGTTCTCCAGG + Intronic
1023865788 7:44237785-44237807 ACCTGGGTTGGGGGTTCTGCAGG + Intronic
1028507082 7:91582605-91582627 CCATGGATTTGGGTATCTGCAGG + Intergenic
1029074896 7:97927873-97927895 CCCAGTCTTGGGGTTGCTCCCGG - Intergenic
1030088912 7:105840290-105840312 CTCTTGACTGGGCTTTCTCCTGG - Intronic
1031227599 7:119060508-119060530 AACTGAATTGGGGTTTCTCTTGG - Intergenic
1036242818 8:7093382-7093404 CCCAGTCTTGGGGTTGCTCCTGG + Intergenic
1036257984 8:7220646-7220668 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036259233 8:7227644-7227666 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036307394 8:7611877-7611899 CCCAGTCTTGGGGTTGCTCCTGG + Intergenic
1036310033 8:7679242-7679264 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036311286 8:7686239-7686261 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036358237 8:8059861-8059883 CCCAGTCTTGGGGTTGCTCCTGG + Intergenic
1036359502 8:8066860-8066882 CCCAGTCTTGGGGTTGCTCCTGG + Intergenic
1036829911 8:12013762-12013784 CCCAGTCTTGGGGTTGCTCCCGG - Intronic
1036891454 8:12600092-12600114 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036892712 8:12607082-12607104 CCCAGTCTTGGGGTTGCTCCTGG - Intergenic
1036899005 8:12658054-12658076 CCCAGTCTTGGGGTTGCTCCCGG - Intergenic
1036900261 8:12665068-12665090 CCCTGTCTTGGGGTTGCTCCCGG - Intergenic
1038085699 8:24193980-24194002 CCCTGGCTGAGGGTTTTTCCAGG - Intergenic
1038607899 8:29027813-29027835 CCCTGTATTTGGGTGTATCCAGG + Intronic
1038765798 8:30426702-30426724 CTATGTCTTGGGGTTTCTCCAGG + Intronic
1039200006 8:35080950-35080972 ACCTGGATTTGGGTATCTGCAGG - Intergenic
1043286293 8:78535865-78535887 CCCTGGATTTTGGTATCTGCGGG + Intronic
1044224250 8:89701508-89701530 CCCAGTATTAGGGTTTCACCAGG - Intergenic
1048511761 8:135069466-135069488 CCCTGTATTCGTGTTTCTCTTGG + Intergenic
1048518073 8:135128581-135128603 TCCTCTACTGGGGTTTCTCCTGG - Intergenic
1049584807 8:143427965-143427987 CCCTGCATTGGGCTTTGTGCTGG - Intronic
1052872774 9:33524122-33524144 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1053503353 9:38620714-38620736 CGCTGGCTTGCGGGTTCTCCTGG + Intergenic
1054351640 9:64021478-64021500 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1056210154 9:84357801-84357823 CCCTGGATTGGGTTATCTCACGG - Intergenic
1057030392 9:91770444-91770466 CCCTGGAGTGGGTGTGCTCCAGG - Intronic
1057684673 9:97221682-97221704 CGCTGGCTTGCGGGTTCTCCTGG + Intergenic
1058500413 9:105609672-105609694 CCCTCATTTGGGGTTTGTCCGGG + Intronic
1060877640 9:127094755-127094777 CCATGGATTGGGCTGTATCCTGG - Intronic
1061998981 9:134206566-134206588 CCCTGCTTTGGGTTTTCCCCTGG - Intergenic
1062170398 9:135131820-135131842 CCCTGGCTTGGGCATTCCCCTGG - Intergenic
1062563359 9:137151455-137151477 CCCTGGGTGGGGCTTTCTTCTGG - Intronic
1203552257 Un_KI270743v1:172462-172484 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic
1189559610 X:42178533-42178555 TCCTTGCTTGGGGTTTCTCATGG - Intergenic
1190745977 X:53321697-53321719 CCTGGGATGGGGGTTCCTCCCGG - Intergenic
1193572578 X:83161967-83161989 TACTGGATTGGGGTTTGGCCTGG - Intergenic
1195218812 X:102726573-102726595 TCCAGAGTTGGGGTTTCTCCAGG - Intronic
1196170783 X:112586935-112586957 CACAGTATTGGGGTGTCTCCTGG - Intergenic
1196829247 X:119763403-119763425 CCCTGGAAAGAGGTTTCTCGGGG - Intergenic
1197057254 X:122135711-122135733 CCATGGGTTGGGGGCTCTCCAGG + Intergenic
1199160827 X:144608980-144609002 TACTGGATTGGGGATGCTCCTGG - Intergenic
1200081698 X:153580019-153580041 TCTTGGATTCTGGTTTCTCCAGG - Exonic
1201153538 Y:11108035-11108057 CGCTGGCTTGCGGGTTCTCCTGG - Intergenic