ID: 949046523

View in Genome Browser
Species Human (GRCh38)
Location 2:241874862-241874884
Sequence CCCTGGATTGGGGTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 3, 1: 4, 2: 5, 3: 20, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046523_949046534 -2 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046534 2:241874883-241874905 GGCCTCGGGGGCCAACTGCAGGG 0: 2
1: 1
2: 3
3: 25
4: 163
949046523_949046533 -3 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046533 2:241874882-241874904 GGGCCTCGGGGGCCAACTGCAGG 0: 2
1: 2
2: 1
3: 20
4: 200
949046523_949046542 29 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046542 2:241874914-241874936 CCCAGGAGAAACCCCAATCCAGG 0: 5
1: 5
2: 3
3: 38
4: 220
949046523_949046537 4 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046537 2:241874889-241874911 GGGGGCCAACTGCAGGGACAGGG 0: 1
1: 1
2: 6
3: 28
4: 265
949046523_949046540 12 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046540 2:241874897-241874919 ACTGCAGGGACAGGGGTCCCAGG 0: 1
1: 1
2: 11
3: 41
4: 360
949046523_949046538 5 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046538 2:241874890-241874912 GGGGCCAACTGCAGGGACAGGGG 0: 1
1: 1
2: 7
3: 23
4: 338
949046523_949046536 3 Left 949046523 2:241874862-241874884 CCAGGAGAAACCCCAATCCAGGG 0: 3
1: 4
2: 5
3: 20
4: 212
Right 949046536 2:241874888-241874910 CGGGGGCCAACTGCAGGGACAGG 0: 1
1: 0
2: 1
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046523 Original CRISPR CCCTGGATTGGGGTTTCTCC TGG (reversed) Intergenic