ID: 949046579

View in Genome Browser
Species Human (GRCh38)
Location 2:241875020-241875042
Sequence CCCTGGATTGGGGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 5, 2: 3, 3: 17, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046579_949046595 28 Left 949046579 2:241875020-241875042 CCAGGGGAAACCCCAATCCAGGG 0: 1
1: 5
2: 3
3: 17
4: 206
Right 949046595 2:241875071-241875093 TCCAGGAAAAACCAGAATCCAGG 0: 1
1: 3
2: 2
3: 23
4: 295
949046579_949046592 5 Left 949046579 2:241875020-241875042 CCAGGGGAAACCCCAATCCAGGG 0: 1
1: 5
2: 3
3: 17
4: 206
Right 949046592 2:241875048-241875070 GGGGCCAACTGCAGGGACAAAGG 0: 1
1: 3
2: 4
3: 29
4: 209
949046579_949046589 -3 Left 949046579 2:241875020-241875042 CCAGGGGAAACCCCAATCCAGGG 0: 1
1: 5
2: 3
3: 17
4: 206
Right 949046589 2:241875040-241875062 GGGCCTCGGGGGCCAACTGCAGG 0: 2
1: 2
2: 1
3: 20
4: 200
949046579_949046594 11 Left 949046579 2:241875020-241875042 CCAGGGGAAACCCCAATCCAGGG 0: 1
1: 5
2: 3
3: 17
4: 206
Right 949046594 2:241875054-241875076 AACTGCAGGGACAAAGGTCCAGG 0: 1
1: 0
2: 6
3: 45
4: 309
949046579_949046590 -2 Left 949046579 2:241875020-241875042 CCAGGGGAAACCCCAATCCAGGG 0: 1
1: 5
2: 3
3: 17
4: 206
Right 949046590 2:241875041-241875063 GGCCTCGGGGGCCAACTGCAGGG 0: 2
1: 1
2: 3
3: 25
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046579 Original CRISPR CCCTGGATTGGGGTTTCCCC TGG (reversed) Intergenic
901311655 1:8274026-8274048 CCCTGAATTTGGGTTTCTCTTGG + Intergenic
901364960 1:8738862-8738884 ACCTGGATTGGAGATTGCCCAGG - Intronic
904594574 1:31635337-31635359 CCCAGGATTGGGGTGTCCATAGG + Exonic
904884399 1:33725453-33725475 CCCTTGATCGGGGTTTACCACGG - Exonic
905293057 1:36936243-36936265 CCCTGGGTTGGGATTCCTCCAGG - Intronic
905442965 1:38006166-38006188 CCGAGGATTAGGGTCTCCCCCGG - Intergenic
905448067 1:38040303-38040325 GCCTGGATTGGGGTTTTAACTGG + Intergenic
905484616 1:38286421-38286443 TCCCCGTTTGGGGTTTCCCCAGG - Intergenic
907281654 1:53350893-53350915 CCCAGGATTAAGGTTTCTCCTGG + Intergenic
909484578 1:76158897-76158919 CCATGCTTTGGGGTTTGCCCAGG + Intronic
912496488 1:110095166-110095188 CCATGGCATTGGGTTTCCCCTGG - Intergenic
914598963 1:149181394-149181416 CTATGCATTGCGGTTTCCCCAGG + Intergenic
920680670 1:208070085-208070107 CCAAGGATGGGGGTGTCCCCTGG - Intronic
1062913946 10:1233250-1233272 CCCTGCAAAGGGGTTTCCCCAGG - Intronic
1063457608 10:6195289-6195311 CCCTGAATGGGGCTTTGCCCAGG + Intronic
1070780464 10:79134615-79134637 ACCTGGATTGAGACTTCCCCAGG + Intronic
1074275622 10:111999274-111999296 GCCTTCAGTGGGGTTTCCCCAGG + Intergenic
1076627257 10:131829647-131829669 CCCTGGAGTGGGGCTGCCCCGGG - Intergenic
1076681148 10:132172006-132172028 CCCTGGGTTCTGGTTTCTCCAGG + Intronic
1077130818 11:971556-971578 CACAGGACTGGGGTTTGCCCTGG + Intronic
1079128416 11:17734547-17734569 CCCTGGAGTGGCGTTCCCCGAGG + Intergenic
1079969308 11:27017128-27017150 GCCTTGATTGGGGTTTCCATGGG - Intergenic
1084031071 11:66480748-66480770 CCCCGGGTTGGGGAATCCCCGGG + Intronic
1084643061 11:70437351-70437373 CCCTGGCTGGGACTTTCCCCTGG - Intergenic
1084728596 11:71058830-71058852 CCCAGGGATGGGGTTCCCCCGGG - Intronic
1086080746 11:82900515-82900537 GGCTGGCTTTGGGTTTCCCCTGG - Intronic
1089397425 11:118145479-118145501 CCTTGGGTTGGGGTGACCCCTGG - Intronic
1089785581 11:120904710-120904732 CCCTTGATTGTGCCTTCCCCTGG + Intronic
1091595281 12:1874418-1874440 CCCTGGCTAGGTGTTTCTCCAGG + Intronic
1093954282 12:25198186-25198208 CCCTGGACTGGGGCATCCTCAGG + Intronic
1097235686 12:57537940-57537962 GCCTGGATTGGGGCTTTCACAGG - Intronic
1098951682 12:76645907-76645929 CCCTGGCTTGGGGATTTCCTAGG - Intergenic
1099321935 12:81161978-81162000 CCCTGGCTTGGGGAGCCCCCAGG + Intronic
1100326052 12:93540778-93540800 CCCTGGATGGGTATTTTCCCAGG + Intergenic
1101778759 12:107817124-107817146 ATCTGTATTGTGGTTTCCCCTGG + Intergenic
1102270796 12:111533302-111533324 CCCTGGATTTTGGTATCCCTAGG - Intronic
1103026822 12:117580802-117580824 CCCTGGATTGGCCATGCCCCTGG - Intronic
1103571521 12:121848136-121848158 CCCTGGACTGTGATGTCCCCAGG + Intronic
1106421432 13:29589298-29589320 CCCTGCAAAGGGGTCTCCCCAGG + Intronic
1109624520 13:64957963-64957985 CCCTAGAGTGGGGACTCCCCAGG + Intergenic
1110421355 13:75313068-75313090 GCCTAGATTGCTGTTTCCCCAGG - Intronic
1111268911 13:85854293-85854315 CCCTGGCTTGGAGGTTCCCTAGG - Intergenic
1113851646 13:113421421-113421443 CCAGGGATGGGGGTGTCCCCAGG - Intergenic
1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG + Intergenic
1116788870 14:49318495-49318517 CACTGCTTTGGGGTTTCTCCAGG + Intergenic
1116884476 14:50206358-50206380 CCATGGATTTGGGTATCCACAGG - Intronic
1117546414 14:56797845-56797867 CCCTCCGTTGGGGTCTCCCCCGG - Intergenic
1118989554 14:70785319-70785341 CCATGGATTGGGGCATCCACTGG - Intronic
1120400259 14:84022529-84022551 CCCAGGAATGGGGTTTCCTGTGG + Intergenic
1121281765 14:92704193-92704215 CCCTGGAGCGGGGGCTCCCCAGG + Exonic
1121303590 14:92890740-92890762 CCCTGGAGAGGCGGTTCCCCTGG + Intergenic
1121368677 14:93337504-93337526 CTCTGGGTTGGGGAATCCCCAGG - Intronic
1121437873 14:93930812-93930834 CCCTGGCCTGGGGAGTCCCCTGG + Intergenic
1124436384 15:29652555-29652577 CCCTGGCTTGGGGAGCCCCCAGG - Intergenic
1124441185 15:29687616-29687638 CCCTGGGCTGGGGTTTGCTCAGG - Intergenic
1125593769 15:40871960-40871982 GCCTGGAAACGGGTTTCCCCAGG - Intergenic
1127124659 15:55800417-55800439 CTGTGGAGTGGGGGTTCCCCAGG + Intergenic
1128100823 15:64998498-64998520 CACTGGATTGTGGTTTCTACAGG + Intergenic
1128965381 15:72052586-72052608 CCCTGGCTTGGGGAGCCCCCAGG - Intronic
1129068975 15:72935634-72935656 CCCTGGAAGGGGATTTCCCCTGG + Intergenic
1130551284 15:84891336-84891358 CCCTGAATTAGGGCTGCCCCAGG + Intronic
1133099437 16:3470280-3470302 GCCTGGCTTGGGGCTTCTCCAGG + Intronic
1136004973 16:27323171-27323193 TCCTGGCTTTGGGTTTGCCCAGG + Intronic
1137510198 16:49092882-49092904 GCCTTGATTGTGGTTTCCACTGG + Intergenic
1139952379 16:70678645-70678667 CGCTGGATTGGGGCATCTCCGGG + Intronic
1141808652 16:86358933-86358955 CCCTGGCTCTGGGTTCCCCCCGG + Intergenic
1142884808 17:2905875-2905897 GCCTGGACTGTGGTCTCCCCAGG - Intronic
1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG + Intronic
1146461383 17:33048709-33048731 CCCTGGATGGGAGTTCTCCCTGG + Intronic
1147478725 17:40738672-40738694 GCCTTTATTGGGGTTTCCACGGG - Intergenic
1150009040 17:61487953-61487975 TGCTGGTTTGGGGTTTCCGCAGG - Intergenic
1151010269 17:70485056-70485078 CCCTGGAATGAGCTTTCCCAGGG + Intergenic
1153504579 18:5782764-5782786 CCCTGGTTTGTAGTTTCACCAGG + Intergenic
1160823723 19:1069693-1069715 ACCGAGATTAGGGTTTCCCCAGG - Intronic
1161030444 19:2055712-2055734 CCCAGCAGTGGGGTTCCCCCTGG + Intergenic
1161312642 19:3603471-3603493 TCCTGCACTGGGATTTCCCCTGG + Intronic
1161416548 19:4150278-4150300 CCCAGGATCTGGGGTTCCCCTGG + Intergenic
1161430478 19:4229447-4229469 CCCTGGGCTGGGCTTTCCCCTGG + Intergenic
1162916025 19:13874845-13874867 GGCTGGATTGGGGGCTCCCCAGG - Intronic
1163848415 19:19650278-19650300 GCCTGGTGTGGGGTTTCCCAAGG - Intronic
1164754553 19:30679991-30680013 CCCTGGCCTGGGTTTTTCCCAGG - Intronic
1165945217 19:39437711-39437733 CCCAGGATTGGGTTGTCCTCTGG + Intronic
1166400079 19:42472038-42472060 GCCCAGATTTGGGTTTCCCCAGG - Intergenic
1167664439 19:50815718-50815740 CCCTGGATGAGGGATTCTCCTGG - Intergenic
926216607 2:10909491-10909513 CCCTCTATTGGGGTTTCCTGGGG - Intergenic
928280946 2:29945736-29945758 CCCAGAATTGGGGTTTAGCCAGG - Intergenic
928749955 2:34459402-34459424 CACAGGAATGGGGTTTCCCAAGG + Intergenic
930229290 2:48827228-48827250 CCCTGGAGTGGGGTTCCCAGAGG + Intergenic
930931305 2:56886484-56886506 CACTGGAGTGGGGTTGCCCAAGG + Intergenic
933443383 2:82344358-82344380 CCATGGATTTGGGTATCCACAGG + Intergenic
934164175 2:89279344-89279366 CTCTGGTCTGGGGTTTCCCTGGG + Intergenic
934203099 2:89903183-89903205 CTCTGGTCTGGGGTTTCCCTGGG - Intergenic
934707683 2:96496185-96496207 CCAGGGATAGGGGTTTCCCATGG + Intergenic
935633102 2:105228109-105228131 TCCTGGATTGGGGTTTCCAAAGG + Intergenic
937560529 2:123218827-123218849 GCCTGGATAGTGGTTTCCCATGG - Intergenic
938116298 2:128605092-128605114 CCCTGGATTTTGGTATCCTCGGG + Intergenic
942047471 2:172108232-172108254 TCCTGGAAGGGGGGTTCCCCTGG + Intergenic
942519754 2:176791073-176791095 CCCTGGACTGGGTTATCACCTGG - Intergenic
943247541 2:185474154-185474176 CCCTAGATTGGGGAGTCCCGGGG - Intergenic
944146833 2:196515000-196515022 CCCTGGCTTGGGGAGTCCCTAGG - Intronic
946321697 2:218958562-218958584 CCCTGGATTTTGGACTCCCCAGG - Intergenic
949046506 2:241874810-241874832 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046523 2:241874862-241874884 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046543 2:241874915-241874937 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046561 2:241874968-241874990 ACCTGGATTGGGGTTTCTCCTGG - Intergenic
949046579 2:241875020-241875042 CCCTGGATTGGGGTTTCCCCTGG - Intergenic
949046612 2:241875124-241875146 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046628 2:241875176-241875198 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046644 2:241875228-241875250 GCCTGGATTCTGGTTTCTCCTGG - Intergenic
949046826 2:241876342-241876364 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046846 2:241876396-241876418 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046862 2:241876449-241876471 ACCTGGACTGAGGTTTCTCCTGG - Intergenic
949046879 2:241876502-241876524 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046895 2:241876553-241876575 ACCTGGATTGAGGTTTCTCCTGG - Intergenic
949046911 2:241876606-241876628 CCCTGGATTCCAGTTTCTCCTGG - Intergenic
949046929 2:241876660-241876682 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
1169309417 20:4522242-4522264 CCCTGGCTTGGGGATCCCCTAGG - Intergenic
1173852879 20:46229863-46229885 CCCTGCATTGTGCTTTGCCCAGG - Intronic
1174258499 20:49277259-49277281 CCCTGGGTCAGGGATTCCCCAGG - Intronic
1175143828 20:56881130-56881152 CCCTGGTTTGGGGCCTCCCTGGG - Intergenic
1176088026 20:63306903-63306925 CCCTGGACTTGGGCTCCCCCAGG + Intronic
1178680202 21:34668255-34668277 CCCTGGGTTAGGGTTCTCCCAGG - Intergenic
1180048253 21:45319622-45319644 CACTGGGCTGGGGTTTCCCAGGG - Intergenic
1180099802 21:45579142-45579164 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099854 21:45579261-45579283 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099883 21:45579329-45579351 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099933 21:45579448-45579470 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099955 21:45579499-45579521 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099990 21:45579583-45579605 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180100057 21:45579770-45579792 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180100076 21:45579821-45579843 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180100094 21:45579855-45579877 CCCTGGGATGGGGGTGCCCCGGG + Intergenic
1181078892 22:20400961-20400983 TCCTTGCTTGGTGTTTCCCCTGG + Intronic
1181085193 22:20436590-20436612 CCCTGGACTCGGCTTGCCCCGGG + Intronic
1181468912 22:23126244-23126266 CCCTGGAGGGAGGTTTCTCCCGG + Intronic
1181754892 22:25016793-25016815 CCCAGAATTGGGGCTTCACCTGG + Intronic
1182754318 22:32666520-32666542 CCCTGGAATGCTCTTTCCCCAGG + Intronic
1183738967 22:39659652-39659674 CCCTGGACTAGGGGTACCCCAGG + Intronic
1184907675 22:47499779-47499801 CCCAGGAGTGGGGGCTCCCCAGG + Intergenic
949766576 3:7533624-7533646 TTCAGGATTGGGGTTTCCTCTGG - Intronic
950121318 3:10484139-10484161 CCCTGGCTTTGGGTTTCCCAAGG + Intronic
950147724 3:10663794-10663816 TCCTGGCATGGGGCTTCCCCTGG + Intronic
951382128 3:21996317-21996339 CCCTGCAGTGGAGTTTCTCCTGG + Intronic
951696163 3:25447682-25447704 GCCTGGATTGGGGATTGGCCAGG + Intronic
952035809 3:29199277-29199299 TTCTGGATTAGGGTTACCCCTGG - Intergenic
953349154 3:42201791-42201813 CCCAGGACTGGGCTTTCCTCAGG + Intronic
953748097 3:45590569-45590591 CCCTGGATTGGGGTGCTCCTAGG + Intronic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
954461469 3:50629360-50629382 CCCTGGCTTTAGGATTCCCCTGG - Intronic
955761216 3:62285157-62285179 CCCAGGCATTGGGTTTCCCCCGG - Intronic
956408855 3:68957711-68957733 CTCTGGTTTGGACTTTCCCCTGG - Intergenic
957072631 3:75578892-75578914 CCCAGTCTTGGGGTTGCCCCTGG - Intergenic
957845099 3:85721736-85721758 CCCTGGAATGGGGTGCTCCCAGG + Intronic
958675477 3:97264523-97264545 CCCTGGATTGGGGAGCTCCCAGG + Intronic
961650205 3:128413386-128413408 CCCTGCACTGGGCTTGCCCCAGG - Intergenic
963598988 3:147361011-147361033 GCCTGGAGTGGGGTTTCTCTTGG + Intergenic
964996864 3:162892343-162892365 CCCTGGCTTGGGGAATTCCCAGG - Intergenic
966452389 3:180076985-180077007 CCCTGGATTTTGGTATCCACAGG - Intergenic
968427826 4:534936-534958 CCCTTGATCTGGGTTTCCCCGGG - Intronic
968979314 4:3838118-3838140 CTCTGCATAGGGGTCTCCCCAGG + Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
970320259 4:14868158-14868180 CCCTGGAGAGGGGTTTCAGCTGG - Intergenic
971371393 4:26022193-26022215 CCCAGGGTTGCTGTTTCCCCTGG + Intergenic
971732655 4:30406246-30406268 CCCTGTATTGGGGTTTCTCTTGG - Intergenic
974094800 4:57351369-57351391 CCCTGGAATGGAGTTTCCAGAGG - Intergenic
975492405 4:75003168-75003190 CCCTGTATTGGGGTTTCTCAGGG - Intronic
977160309 4:93626083-93626105 CCCTGGATTTTGGTATCCACAGG + Intronic
984140675 4:176001378-176001400 CCCTGGACTGGCGTATCCACAGG - Intronic
984818586 4:183860333-183860355 TCCTGGATTGGGGTTTTGGCTGG - Intronic
986101257 5:4613802-4613824 ACCTGGATTTGGGCTGCCCCTGG + Intergenic
986173470 5:5332395-5332417 CCCTGGAGTGCCATTTCCCCTGG + Intergenic
988073686 5:26325602-26325624 CACTGGCTTGGGGATTTCCCAGG + Intergenic
990228094 5:53679484-53679506 AACTGGTTTGGGTTTTCCCCTGG - Intronic
994851336 5:105057939-105057961 CCCTGGCTTGGGGAATTCCCAGG - Intergenic
997471433 5:134119590-134119612 CCCTGGCTTGGGGCATCCCCAGG - Intronic
997693404 5:135843189-135843211 CCCTGCATTGGGATGTCCCCTGG - Intronic
997882276 5:137601695-137601717 TCCTGGATTTGGGGTTCCCACGG - Intergenic
1000971474 5:167719465-167719487 AGCTGGAGTGGGGTTTCCACAGG + Intronic
1001333163 5:170776621-170776643 CCCTGGCTTGGCATTTTCCCCGG - Intronic
1002184718 5:177448800-177448822 CCAGGGCTTGGGGTTTTCCCAGG - Intronic
1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG + Intronic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1002889904 6:1323650-1323672 CCATGGATGGTGGCTTCCCCAGG - Intergenic
1006372705 6:33655313-33655335 CACTGGATAGGGGCTGCCCCTGG + Intronic
1010087866 6:71941808-71941830 CCCTGGATTGGTGTAGCACCTGG - Intronic
1010205075 6:73315173-73315195 CCCTGGTGTTGGGTGTCCCCTGG + Intergenic
1012976882 6:105789722-105789744 CCCAGGATAGGTGTTTCCTCTGG - Intergenic
1014384801 6:120786704-120786726 CCCTGGCTTGGGGAATCCCTAGG - Intergenic
1018426353 6:163686547-163686569 TCATGGAGTTGGGTTTCCCCTGG - Intergenic
1019913104 7:4113489-4113511 CCCTGGATTAGTGTGTGCCCTGG - Intronic
1035393982 7:158523710-158523732 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035393994 7:158523767-158523789 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394002 7:158523804-158523826 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394018 7:158523881-158523903 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394039 7:158523972-158523994 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394051 7:158524029-158524051 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394067 7:158524106-158524128 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394075 7:158524143-158524165 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394091 7:158524220-158524242 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394112 7:158524311-158524333 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394124 7:158524368-158524390 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394156 7:158524513-158524535 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1035394160 7:158524530-158524552 CCCTGGAGTGGAGTCTGCCCTGG + Intronic
1036761870 8:11514946-11514968 CCCTGGAGTGGGAGCTCCCCAGG - Intronic
1036900261 8:12665068-12665090 CCCTGTCTTGGGGTTGCTCCCGG - Intergenic
1038699020 8:29832387-29832409 CCCTTTATTGTGGTTTCCACTGG + Intergenic
1039288943 8:36073159-36073181 TTCGGGATTGGTGTTTCCCCTGG - Intergenic
1041205422 8:55494321-55494343 CCCTGGCTTGGGGAGTTCCCAGG + Intronic
1041454911 8:58048398-58048420 CCCATTATTGGGGTTTCCTCAGG + Intronic
1041947173 8:63458859-63458881 CCCTGGATTTTGGTATCCACGGG - Intergenic
1043964249 8:86454110-86454132 CCATGGATTGTGGTGTCCACAGG - Intronic
1044224250 8:89701508-89701530 CCCAGTATTAGGGTTTCACCAGG - Intergenic
1044834380 8:96281478-96281500 CCCTGGATTAGGGTGGTCCCTGG + Intronic
1045836809 8:106531988-106532010 CACTGAATTGAGGTTTACCCAGG - Intronic
1047425389 8:124740791-124740813 CCATTAATTGGGATTTCCCCTGG + Intergenic
1053005077 9:34598986-34599008 CCCTGGTTTTTGGTCTCCCCAGG + Intergenic
1056210154 9:84357801-84357823 CCCTGGATTGGGTTATCTCACGG - Intergenic
1056807590 9:89740934-89740956 GCCTTTATTGGGGTTTCCGCAGG - Intergenic
1060759317 9:126234718-126234740 CCCTGGCTTGGGCTTCCCCTGGG + Intergenic
1061394955 9:130338628-130338650 CCCAGGAGTGGGTGTTCCCCTGG + Intronic
1061614675 9:131772096-131772118 CCATCGAATGGGGTGTCCCCAGG + Intergenic
1061998981 9:134206566-134206588 CCCTGCTTTGGGTTTTCCCCTGG - Intergenic
1062170398 9:135131820-135131842 CCCTGGCTTGGGCATTCCCCTGG - Intergenic
1062563062 9:137150406-137150428 CCCTGGGTGGGGCTTTCCCTGGG - Intronic
1062563106 9:137150570-137150592 CCCTGGGTGGGGCTTTCCCTGGG - Intronic
1189435322 X:40987732-40987754 GCCTTTATTGGGGTTTCCGCAGG - Intergenic
1193572578 X:83161967-83161989 TACTGGATTGGGGTTTGGCCTGG - Intergenic
1194953486 X:100153471-100153493 CCCTGGAATGGAGTTTCCAGAGG - Intergenic
1198034063 X:132783643-132783665 CCCAGGCTTGGGGTCTCCCTGGG - Intronic
1198146144 X:133859397-133859419 CCCAGGCTTGGGGTCTCCCTGGG + Intronic
1199854341 X:151747918-151747940 TCTTGGATTTGGTTTTCCCCAGG + Intergenic
1200062719 X:153490739-153490761 CCCTGGATGGGAATTTGCCCTGG + Intronic