ID: 949046826

View in Genome Browser
Species Human (GRCh38)
Location 2:241876342-241876364
Sequence CCCTGGATTGGGGTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046826_949046842 14 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046842 2:241876379-241876401 CTGCAGGGACGAGGATCCCAGGG No data
949046826_949046843 15 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046843 2:241876380-241876402 TGCAGGGACGAGGATCCCAGGGG No data
949046826_949046845 30 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046845 2:241876395-241876417 CCCAGGGGAAACCCCAATCCAGG No data
949046826_949046835 -2 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046835 2:241876363-241876385 GGCCTCAGGGGCCCAACTGCAGG No data
949046826_949046838 5 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046838 2:241876370-241876392 GGGGCCCAACTGCAGGGACGAGG No data
949046826_949046841 13 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046841 2:241876378-241876400 ACTGCAGGGACGAGGATCCCAGG No data
949046826_949046836 -1 Left 949046826 2:241876342-241876364 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046836 2:241876364-241876386 GCCTCAGGGGCCCAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046826 Original CRISPR CCCTGGATTGGGGTTTCTCC TGG (reversed) Intergenic