ID: 949046846

View in Genome Browser
Species Human (GRCh38)
Location 2:241876396-241876418
Sequence ACCTGGATTGGGGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046846_949046859 12 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046846_949046853 -7 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046846_949046856 -2 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data
949046846_949046855 -3 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046855 2:241876416-241876438 GGTCTCAGGGGCCCAATGGCAGG No data
949046846_949046861 29 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046846 Original CRISPR ACCTGGATTGGGGTTTCCCC TGG (reversed) Intergenic