ID: 949046853

View in Genome Browser
Species Human (GRCh38)
Location 2:241876412-241876434
Sequence TCCAGGTCTCAGGGGCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046840_949046853 14 Left 949046840 2:241876375-241876397 CCAACTGCAGGGACGAGGATCCC No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046839_949046853 15 Left 949046839 2:241876374-241876396 CCCAACTGCAGGGACGAGGATCC No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046834_949046853 30 Left 949046834 2:241876359-241876381 CCAGGGCCTCAGGGGCCCAACTG No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046844_949046853 -6 Left 949046844 2:241876395-241876417 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046837_949046853 24 Left 949046837 2:241876365-241876387 CCTCAGGGGCCCAACTGCAGGGA No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data
949046846_949046853 -7 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046853 2:241876412-241876434 TCCAGGTCTCAGGGGCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046853 Original CRISPR TCCAGGTCTCAGGGGCCCAA TGG Intergenic