ID: 949046856

View in Genome Browser
Species Human (GRCh38)
Location 2:241876417-241876439
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046839_949046856 20 Left 949046839 2:241876374-241876396 CCCAACTGCAGGGACGAGGATCC No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data
949046846_949046856 -2 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data
949046844_949046856 -1 Left 949046844 2:241876395-241876417 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data
949046837_949046856 29 Left 949046837 2:241876365-241876387 CCTCAGGGGCCCAACTGCAGGGA No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data
949046840_949046856 19 Left 949046840 2:241876375-241876397 CCAACTGCAGGGACGAGGATCCC No data
Right 949046856 2:241876417-241876439 GTCTCAGGGGCCCAATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type