ID: 949046859

View in Genome Browser
Species Human (GRCh38)
Location 2:241876431-241876453
Sequence ATGGCAGGGACGAGAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046846_949046859 12 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046852_949046859 0 Left 949046852 2:241876408-241876430 CCAATCCAGGTCTCAGGGGCCCA No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046844_949046859 13 Left 949046844 2:241876395-241876417 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046854_949046859 -5 Left 949046854 2:241876413-241876435 CCAGGTCTCAGGGGCCCAATGGC No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046851_949046859 1 Left 949046851 2:241876407-241876429 CCCAATCCAGGTCTCAGGGGCCC No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data
949046850_949046859 2 Left 949046850 2:241876406-241876428 CCCCAATCCAGGTCTCAGGGGCC No data
Right 949046859 2:241876431-241876453 ATGGCAGGGACGAGAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046859 Original CRISPR ATGGCAGGGACGAGAATCCC AGG Intergenic