ID: 949046861

View in Genome Browser
Species Human (GRCh38)
Location 2:241876448-241876470
Sequence CCCAGGAGAAACCTCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046854_949046861 12 Left 949046854 2:241876413-241876435 CCAGGTCTCAGGGGCCCAATGGC No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046850_949046861 19 Left 949046850 2:241876406-241876428 CCCCAATCCAGGTCTCAGGGGCC No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046858_949046861 -3 Left 949046858 2:241876428-241876450 CCAATGGCAGGGACGAGAATCCC No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046844_949046861 30 Left 949046844 2:241876395-241876417 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046851_949046861 18 Left 949046851 2:241876407-241876429 CCCAATCCAGGTCTCAGGGGCCC No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046857_949046861 -2 Left 949046857 2:241876427-241876449 CCCAATGGCAGGGACGAGAATCC No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046846_949046861 29 Left 949046846 2:241876396-241876418 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data
949046852_949046861 17 Left 949046852 2:241876408-241876430 CCAATCCAGGTCTCAGGGGCCCA No data
Right 949046861 2:241876448-241876470 CCCAGGAGAAACCTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046861 Original CRISPR CCCAGGAGAAACCTCAGTCC AGG Intergenic