ID: 949046879

View in Genome Browser
Species Human (GRCh38)
Location 2:241876502-241876524
Sequence ACCTGGATTGGGGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046879_949046889 2 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046879_949046885 -9 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data
949046879_949046892 10 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046879_949046888 -4 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046888 2:241876521-241876543 AGGTCTCGGGCCCAACGGCAGGG No data
949046879_949046894 27 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046879_949046887 -5 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046887 2:241876520-241876542 CAGGTCTCGGGCCCAACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046879 Original CRISPR ACCTGGATTGGGGTTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr