ID: 949046885

View in Genome Browser
Species Human (GRCh38)
Location 2:241876516-241876538
Sequence AATCCAGGTCTCGGGCCCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046867_949046885 27 Left 949046867 2:241876466-241876488 CCAGGTCTCAGGGGCCCAACTGC No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data
949046877_949046885 -8 Left 949046877 2:241876501-241876523 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data
949046879_949046885 -9 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data
949046873_949046885 12 Left 949046873 2:241876481-241876503 CCAACTGCAGGGACGAGGGTCCC No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data
949046872_949046885 13 Left 949046872 2:241876480-241876502 CCCAACTGCAGGGACGAGGGTCC No data
Right 949046885 2:241876516-241876538 AATCCAGGTCTCGGGCCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046885 Original CRISPR AATCCAGGTCTCGGGCCCAA CGG Intergenic