ID: 949046888

View in Genome Browser
Species Human (GRCh38)
Location 2:241876521-241876543
Sequence AGGTCTCGGGCCCAACGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046872_949046888 18 Left 949046872 2:241876480-241876502 CCCAACTGCAGGGACGAGGGTCC No data
Right 949046888 2:241876521-241876543 AGGTCTCGGGCCCAACGGCAGGG No data
949046879_949046888 -4 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046888 2:241876521-241876543 AGGTCTCGGGCCCAACGGCAGGG No data
949046877_949046888 -3 Left 949046877 2:241876501-241876523 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046888 2:241876521-241876543 AGGTCTCGGGCCCAACGGCAGGG No data
949046873_949046888 17 Left 949046873 2:241876481-241876503 CCAACTGCAGGGACGAGGGTCCC No data
Right 949046888 2:241876521-241876543 AGGTCTCGGGCCCAACGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046888 Original CRISPR AGGTCTCGGGCCCAACGGCA GGG Intergenic