ID: 949046889

View in Genome Browser
Species Human (GRCh38)
Location 2:241876527-241876549
Sequence CGGGCCCAACGGCAGGGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046882_949046889 -8 Left 949046882 2:241876512-241876534 CCCCAATCCAGGTCTCGGGCCCA No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046873_949046889 23 Left 949046873 2:241876481-241876503 CCAACTGCAGGGACGAGGGTCCC No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046872_949046889 24 Left 949046872 2:241876480-241876502 CCCAACTGCAGGGACGAGGGTCC No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046883_949046889 -9 Left 949046883 2:241876513-241876535 CCCAATCCAGGTCTCGGGCCCAA No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046877_949046889 3 Left 949046877 2:241876501-241876523 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046879_949046889 2 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data
949046884_949046889 -10 Left 949046884 2:241876514-241876536 CCAATCCAGGTCTCGGGCCCAAC No data
Right 949046889 2:241876527-241876549 CGGGCCCAACGGCAGGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046889 Original CRISPR CGGGCCCAACGGCAGGGACG AGG Intergenic