ID: 949046892

View in Genome Browser
Species Human (GRCh38)
Location 2:241876535-241876557
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046877_949046892 11 Left 949046877 2:241876501-241876523 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046879_949046892 10 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046883_949046892 -1 Left 949046883 2:241876513-241876535 CCCAATCCAGGTCTCGGGCCCAA No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046884_949046892 -2 Left 949046884 2:241876514-241876536 CCAATCCAGGTCTCGGGCCCAAC No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046882_949046892 0 Left 949046882 2:241876512-241876534 CCCCAATCCAGGTCTCGGGCCCA No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data
949046886_949046892 -7 Left 949046886 2:241876519-241876541 CCAGGTCTCGGGCCCAACGGCAG No data
Right 949046892 2:241876535-241876557 ACGGCAGGGACGAGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type