ID: 949046894

View in Genome Browser
Species Human (GRCh38)
Location 2:241876552-241876574
Sequence CCCAGGAGAAACCTCAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046877_949046894 28 Left 949046877 2:241876501-241876523 CCCAGGGGAAACCCCAATCCAGG No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046883_949046894 16 Left 949046883 2:241876513-241876535 CCCAATCCAGGTCTCGGGCCCAA No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046882_949046894 17 Left 949046882 2:241876512-241876534 CCCCAATCCAGGTCTCGGGCCCA No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046884_949046894 15 Left 949046884 2:241876514-241876536 CCAATCCAGGTCTCGGGCCCAAC No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046891_949046894 -3 Left 949046891 2:241876532-241876554 CCAACGGCAGGGACGAGGATCCC No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046886_949046894 10 Left 949046886 2:241876519-241876541 CCAGGTCTCGGGCCCAACGGCAG No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046890_949046894 -2 Left 949046890 2:241876531-241876553 CCCAACGGCAGGGACGAGGATCC No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data
949046879_949046894 27 Left 949046879 2:241876502-241876524 CCAGGGGAAACCCCAATCCAGGT No data
Right 949046894 2:241876552-241876574 CCCAGGAGAAACCTCAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046894 Original CRISPR CCCAGGAGAAACCTCAATCC AGG Intergenic