ID: 949046919

View in Genome Browser
Species Human (GRCh38)
Location 2:241876630-241876652
Sequence GTCCCTGCATTTCGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046919_949046931 14 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046931 2:241876667-241876689 AAACCCCAATCCAGGGCCTCAGG No data
949046919_949046933 16 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046919_949046930 7 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046930 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
949046919_949046938 27 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG No data
949046919_949046932 15 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046932 2:241876668-241876690 AACCCCAATCCAGGGCCTCAGGG No data
949046919_949046928 6 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046919_949046939 28 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046919 Original CRISPR GTCCCTGCATTTCGGCCCCT GGG (reversed) Intergenic