ID: 949046920

View in Genome Browser
Species Human (GRCh38)
Location 2:241876631-241876653
Sequence CGTCCCTGCATTTCGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046920_949046932 14 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046932 2:241876668-241876690 AACCCCAATCCAGGGCCTCAGGG No data
949046920_949046939 27 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046920_949046930 6 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046930 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
949046920_949046928 5 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046920_949046933 15 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046920_949046938 26 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG No data
949046920_949046931 13 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046931 2:241876667-241876689 AAACCCCAATCCAGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046920 Original CRISPR CGTCCCTGCATTTCGGCCCC TGG (reversed) Intergenic