ID: 949046925

View in Genome Browser
Species Human (GRCh38)
Location 2:241876638-241876660
Sequence GGACCCCCGTCCCTGCATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046925_949046938 19 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG No data
949046925_949046928 -2 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046925_949046931 6 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046931 2:241876667-241876689 AAACCCCAATCCAGGGCCTCAGG No data
949046925_949046933 8 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046925_949046941 26 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046925_949046942 27 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046942 2:241876688-241876710 GGGGCCAACTGCAGGGACGAGGG No data
949046925_949046930 -1 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046930 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
949046925_949046932 7 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046932 2:241876668-241876690 AACCCCAATCCAGGGCCTCAGGG No data
949046925_949046939 20 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046925 Original CRISPR GGACCCCCGTCCCTGCATTT CGG (reversed) Intergenic