ID: 949046927

View in Genome Browser
Species Human (GRCh38)
Location 2:241876659-241876681
Sequence CCTGGATTGGGGTTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046927_949046939 -1 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046927_949046945 22 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046945 2:241876704-241876726 ACGAGGGTCCCAGGAGAAACTGG No data
949046927_949046947 30 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046927_949046938 -2 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG No data
949046927_949046942 6 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046942 2:241876688-241876710 GGGGCCAACTGCAGGGACGAGGG No data
949046927_949046941 5 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046927_949046944 13 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046927 Original CRISPR CCTGGATTGGGGTTTCTCCT GGG (reversed) Intergenic