ID: 949046928

View in Genome Browser
Species Human (GRCh38)
Location 2:241876659-241876681
Sequence CCCAGGAGAAACCCCAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046920_949046928 5 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046911_949046928 30 Left 949046911 2:241876606-241876628 CCAGGAGAAACTGGAATCCAGGG No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046916_949046928 13 Left 949046916 2:241876623-241876645 CCAGGGTCCCAGGGGCCGAAATG No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046925_949046928 -2 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
949046919_949046928 6 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046928 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046928 Original CRISPR CCCAGGAGAAACCCCAATCC AGG Intergenic