ID: 949046929

View in Genome Browser
Species Human (GRCh38)
Location 2:241876660-241876682
Sequence CCCTGGATTGGGGTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046929_949046949 30 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046929_949046947 29 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046929_949046938 -3 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG No data
949046929_949046942 5 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046942 2:241876688-241876710 GGGGCCAACTGCAGGGACGAGGG No data
949046929_949046944 12 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046929_949046941 4 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046929_949046939 -2 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046929_949046945 21 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046945 2:241876704-241876726 ACGAGGGTCCCAGGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046929 Original CRISPR CCCTGGATTGGGGTTTCTCC TGG (reversed) Intergenic