ID: 949046933

View in Genome Browser
Species Human (GRCh38)
Location 2:241876669-241876691
Sequence ACCCCAATCCAGGGCCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046919_949046933 16 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046925_949046933 8 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046920_949046933 15 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data
949046916_949046933 23 Left 949046916 2:241876623-241876645 CCAGGGTCCCAGGGGCCGAAATG No data
Right 949046933 2:241876669-241876691 ACCCCAATCCAGGGCCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046933 Original CRISPR ACCCCAATCCAGGGCCTCAG GGG Intergenic