ID: 949046939

View in Genome Browser
Species Human (GRCh38)
Location 2:241876681-241876703
Sequence GGCCTCAGGGGCCAACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046929_949046939 -2 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046920_949046939 27 Left 949046920 2:241876631-241876653 CCAGGGGCCGAAATGCAGGGACG No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046925_949046939 20 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046927_949046939 -1 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG 0: 5
1: 4
2: 2
3: 24
4: 221
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data
949046919_949046939 28 Left 949046919 2:241876630-241876652 CCCAGGGGCCGAAATGCAGGGAC 0: 1
1: 0
2: 4
3: 7
4: 118
Right 949046939 2:241876681-241876703 GGCCTCAGGGGCCAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046939 Original CRISPR GGCCTCAGGGGCCAACTGCA GGG Intergenic