ID: 949046941

View in Genome Browser
Species Human (GRCh38)
Location 2:241876687-241876709
Sequence AGGGGCCAACTGCAGGGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046927_949046941 5 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046936_949046941 -8 Left 949046936 2:241876672-241876694 CCAATCCAGGGCCTCAGGGGCCA No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046929_949046941 4 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046925_949046941 26 Left 949046925 2:241876638-241876660 CCGAAATGCAGGGACGGGGGTCC No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046934_949046941 -6 Left 949046934 2:241876670-241876692 CCCCAATCCAGGGCCTCAGGGGC No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data
949046935_949046941 -7 Left 949046935 2:241876671-241876693 CCCAATCCAGGGCCTCAGGGGCC No data
Right 949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046941 Original CRISPR AGGGGCCAACTGCAGGGACG AGG Intergenic