ID: 949046944

View in Genome Browser
Species Human (GRCh38)
Location 2:241876695-241876717
Sequence ACTGCAGGGACGAGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046934_949046944 2 Left 949046934 2:241876670-241876692 CCCCAATCCAGGGCCTCAGGGGC No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046936_949046944 0 Left 949046936 2:241876672-241876694 CCAATCCAGGGCCTCAGGGGCCA No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046937_949046944 -5 Left 949046937 2:241876677-241876699 CCAGGGCCTCAGGGGCCAACTGC No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046927_949046944 13 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG 0: 5
1: 4
2: 2
3: 24
4: 221
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046929_949046944 12 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data
949046935_949046944 1 Left 949046935 2:241876671-241876693 CCCAATCCAGGGCCTCAGGGGCC No data
Right 949046944 2:241876695-241876717 ACTGCAGGGACGAGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046944 Original CRISPR ACTGCAGGGACGAGGGTCCC AGG Intergenic