ID: 949046947

View in Genome Browser
Species Human (GRCh38)
Location 2:241876712-241876734
Sequence CCCAGGAGAAACTGGAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046937_949046947 12 Left 949046937 2:241876677-241876699 CCAGGGCCTCAGGGGCCAACTGC No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046927_949046947 30 Left 949046927 2:241876659-241876681 CCCAGGAGAAACCCCAATCCAGG No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046934_949046947 19 Left 949046934 2:241876670-241876692 CCCCAATCCAGGGCCTCAGGGGC No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046940_949046947 6 Left 949046940 2:241876683-241876705 CCTCAGGGGCCAACTGCAGGGAC No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046943_949046947 -3 Left 949046943 2:241876692-241876714 CCAACTGCAGGGACGAGGGTCCC No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046929_949046947 29 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046936_949046947 17 Left 949046936 2:241876672-241876694 CCAATCCAGGGCCTCAGGGGCCA No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data
949046935_949046947 18 Left 949046935 2:241876671-241876693 CCCAATCCAGGGCCTCAGGGGCC No data
Right 949046947 2:241876712-241876734 CCCAGGAGAAACTGGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949046947 Original CRISPR CCCAGGAGAAACTGGAGTCC AGG Intergenic