ID: 949046949

View in Genome Browser
Species Human (GRCh38)
Location 2:241876713-241876735
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949046940_949046949 7 Left 949046940 2:241876683-241876705 CCTCAGGGGCCAACTGCAGGGAC No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046934_949046949 20 Left 949046934 2:241876670-241876692 CCCCAATCCAGGGCCTCAGGGGC No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046929_949046949 30 Left 949046929 2:241876660-241876682 CCAGGAGAAACCCCAATCCAGGG No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046937_949046949 13 Left 949046937 2:241876677-241876699 CCAGGGCCTCAGGGGCCAACTGC No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046935_949046949 19 Left 949046935 2:241876671-241876693 CCCAATCCAGGGCCTCAGGGGCC No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046943_949046949 -2 Left 949046943 2:241876692-241876714 CCAACTGCAGGGACGAGGGTCCC No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data
949046936_949046949 18 Left 949046936 2:241876672-241876694 CCAATCCAGGGCCTCAGGGGCCA No data
Right 949046949 2:241876713-241876735 CCAGGAGAAACTGGAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type