ID: 949048058

View in Genome Browser
Species Human (GRCh38)
Location 2:241881361-241881383
Sequence GATGCACAGAGAAAAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048058_949048062 -9 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048062 2:241881375-241881397 CTGTGCATCCTCAGTGACGCGGG No data
949048058_949048071 29 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048058_949048068 10 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048068 2:241881394-241881416 CGGGGCACAGCTCTGCCCGGGGG No data
949048058_949048067 9 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048067 2:241881393-241881415 GCGGGGCACAGCTCTGCCCGGGG No data
949048058_949048061 -10 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048061 2:241881374-241881396 TCTGTGCATCCTCAGTGACGCGG No data
949048058_949048065 7 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048065 2:241881391-241881413 ACGCGGGGCACAGCTCTGCCCGG No data
949048058_949048063 -8 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048063 2:241881376-241881398 TGTGCATCCTCAGTGACGCGGGG No data
949048058_949048066 8 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048058 Original CRISPR GATGCACAGAGAAAAAGGAA GGG (reversed) Intergenic