ID: 949048060

View in Genome Browser
Species Human (GRCh38)
Location 2:241881366-241881388
Sequence CTGAGGATGCACAGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048060_949048066 3 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048060_949048067 4 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048067 2:241881393-241881415 GCGGGGCACAGCTCTGCCCGGGG No data
949048060_949048068 5 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048068 2:241881394-241881416 CGGGGCACAGCTCTGCCCGGGGG No data
949048060_949048065 2 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048065 2:241881391-241881413 ACGCGGGGCACAGCTCTGCCCGG No data
949048060_949048071 24 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048060 Original CRISPR CTGAGGATGCACAGAGAAAA AGG (reversed) Intergenic