ID: 949048064

View in Genome Browser
Species Human (GRCh38)
Location 2:241881383-241881405
Sequence AGCTGTGCCCCGCGTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048064_949048074 19 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048074 2:241881425-241881447 AGCCCACCTGGACCCCACACTGG No data
949048064_949048079 30 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 218
949048064_949048071 7 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048064_949048075 20 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048075 2:241881426-241881448 GCCCACCTGGACCCCACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048064 Original CRISPR AGCTGTGCCCCGCGTCACTG AGG (reversed) Intergenic