ID: 949048066

View in Genome Browser
Species Human (GRCh38)
Location 2:241881392-241881414
Sequence CGCGGGGCACAGCTCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048059_949048066 7 Left 949048059 2:241881362-241881384 CCTTCCTTTTTCTCTGTGCATCC No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048055_949048066 15 Left 949048055 2:241881354-241881376 CCTCCGCCCCTTCCTTTTTCTCT No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048054_949048066 21 Left 949048054 2:241881348-241881370 CCGCTTCCTCCGCCCCTTCCTTT No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048057_949048066 9 Left 949048057 2:241881360-241881382 CCCCTTCCTTTTTCTCTGTGCAT No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048058_949048066 8 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048060_949048066 3 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data
949048056_949048066 12 Left 949048056 2:241881357-241881379 CCGCCCCTTCCTTTTTCTCTGTG No data
Right 949048066 2:241881392-241881414 CGCGGGGCACAGCTCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048066 Original CRISPR CGCGGGGCACAGCTCTGCCC GGG Intergenic