ID: 949048070

View in Genome Browser
Species Human (GRCh38)
Location 2:241881410-241881432
Sequence GGTGGGCTCTGGTAGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048070_949048090 28 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048070_949048083 8 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048070_949048088 24 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048070_949048085 14 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048085 2:241881447-241881469 GGTCAGCCCTGGTGCGGAGGAGG No data
949048070_949048089 27 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048089 2:241881460-241881482 GCGGAGGAGGCCGCTGTAGGTGG No data
949048070_949048084 11 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048084 2:241881444-241881466 CTGGGTCAGCCCTGGTGCGGAGG No data
949048070_949048075 -7 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048075 2:241881426-241881448 GCCCACCTGGACCCCACACTGGG No data
949048070_949048079 3 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048070_949048074 -8 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048074 2:241881425-241881447 AGCCCACCTGGACCCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048070 Original CRISPR GGTGGGCTCTGGTAGGCCCC CGG (reversed) Intergenic