ID: 949048071

View in Genome Browser
Species Human (GRCh38)
Location 2:241881413-241881435
Sequence GGGGCCTACCAGAGCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048059_949048071 28 Left 949048059 2:241881362-241881384 CCTTCCTTTTTCTCTGTGCATCC No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048057_949048071 30 Left 949048057 2:241881360-241881382 CCCCTTCCTTTTTCTCTGTGCAT No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048058_949048071 29 Left 949048058 2:241881361-241881383 CCCTTCCTTTTTCTCTGTGCATC No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048060_949048071 24 Left 949048060 2:241881366-241881388 CCTTTTTCTCTGTGCATCCTCAG No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data
949048064_949048071 7 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048071 2:241881413-241881435 GGGGCCTACCAGAGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048071 Original CRISPR GGGGCCTACCAGAGCCCACC TGG Intergenic