ID: 949048072

View in Genome Browser
Species Human (GRCh38)
Location 2:241881417-241881439
Sequence GGGTCCAGGTGGGCTCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048072_949048085 7 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048085 2:241881447-241881469 GGTCAGCCCTGGTGCGGAGGAGG No data
949048072_949048089 20 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048089 2:241881460-241881482 GCGGAGGAGGCCGCTGTAGGTGG No data
949048072_949048079 -4 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048072_949048088 17 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048072_949048093 28 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG No data
949048072_949048083 1 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048072_949048090 21 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048072_949048084 4 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048084 2:241881444-241881466 CTGGGTCAGCCCTGGTGCGGAGG No data
949048072_949048091 26 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048072_949048092 27 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048092 2:241881467-241881489 AGGCCGCTGTAGGTGGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048072 Original CRISPR GGGTCCAGGTGGGCTCTGGT AGG (reversed) Intergenic