ID: 949048073

View in Genome Browser
Species Human (GRCh38)
Location 2:241881421-241881443
Sequence TGTGGGGTCCAGGTGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048073_949048079 -8 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048073_949048089 16 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048089 2:241881460-241881482 GCGGAGGAGGCCGCTGTAGGTGG No data
949048073_949048083 -3 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048073_949048090 17 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048073_949048085 3 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048085 2:241881447-241881469 GGTCAGCCCTGGTGCGGAGGAGG No data
949048073_949048093 24 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG No data
949048073_949048088 13 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048073_949048091 22 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048073_949048084 0 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048084 2:241881444-241881466 CTGGGTCAGCCCTGGTGCGGAGG No data
949048073_949048092 23 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048092 2:241881467-241881489 AGGCCGCTGTAGGTGGGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048073 Original CRISPR TGTGGGGTCCAGGTGGGCTC TGG (reversed) Intergenic