ID: 949048075

View in Genome Browser
Species Human (GRCh38)
Location 2:241881426-241881448
Sequence GCCCACCTGGACCCCACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048070_949048075 -7 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048075 2:241881426-241881448 GCCCACCTGGACCCCACACTGGG No data
949048064_949048075 20 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048075 2:241881426-241881448 GCCCACCTGGACCCCACACTGGG No data
949048069_949048075 -6 Left 949048069 2:241881409-241881431 CCCGGGGGCCTACCAGAGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 201
Right 949048075 2:241881426-241881448 GCCCACCTGGACCCCACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048075 Original CRISPR GCCCACCTGGACCCCACACT GGG Intergenic