ID: 949048076

View in Genome Browser
Species Human (GRCh38)
Location 2:241881427-241881449
Sequence ACCCAGTGTGGGGTCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048076_949048090 11 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048076_949048085 -3 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048085 2:241881447-241881469 GGTCAGCCCTGGTGCGGAGGAGG No data
949048076_949048084 -6 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048084 2:241881444-241881466 CTGGGTCAGCCCTGGTGCGGAGG No data
949048076_949048092 17 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048092 2:241881467-241881489 AGGCCGCTGTAGGTGGGCACGGG No data
949048076_949048091 16 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048076_949048089 10 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048089 2:241881460-241881482 GCGGAGGAGGCCGCTGTAGGTGG No data
949048076_949048083 -9 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048076_949048088 7 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048076_949048093 18 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048076 Original CRISPR ACCCAGTGTGGGGTCCAGGT GGG (reversed) Intergenic