ID: 949048079

View in Genome Browser
Species Human (GRCh38)
Location 2:241881436-241881458
Sequence ACCCCACACTGGGTCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048073_949048079 -8 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048070_949048079 3 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048069_949048079 4 Left 949048069 2:241881409-241881431 CCCGGGGGCCTACCAGAGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 201
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048072_949048079 -4 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data
949048064_949048079 30 Left 949048064 2:241881383-241881405 CCTCAGTGACGCGGGGCACAGCT No data
Right 949048079 2:241881436-241881458 ACCCCACACTGGGTCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048079 Original CRISPR ACCCCACACTGGGTCAGCCC TGG Intergenic