ID: 949048082

View in Genome Browser
Species Human (GRCh38)
Location 2:241881439-241881461
Sequence GCACCAGGGCTGACCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048082_949048098 27 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048082_949048096 22 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048096 2:241881484-241881506 CACGGGGCAGCACGCGTTAAGGG No data
949048082_949048097 23 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048097 2:241881485-241881507 ACGGGGCAGCACGCGTTAAGGGG No data
949048082_949048092 5 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048092 2:241881467-241881489 AGGCCGCTGTAGGTGGGCACGGG No data
949048082_949048093 6 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG No data
949048082_949048090 -1 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048090 2:241881461-241881483 CGGAGGAGGCCGCTGTAGGTGGG No data
949048082_949048091 4 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048082_949048089 -2 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048089 2:241881460-241881482 GCGGAGGAGGCCGCTGTAGGTGG No data
949048082_949048088 -5 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048082_949048095 21 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048082 Original CRISPR GCACCAGGGCTGACCCAGTG TGG (reversed) Intergenic