ID: 949048083

View in Genome Browser
Species Human (GRCh38)
Location 2:241881441-241881463
Sequence ACACTGGGTCAGCCCTGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048073_949048083 -3 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048070_949048083 8 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048069_949048083 9 Left 949048069 2:241881409-241881431 CCCGGGGGCCTACCAGAGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 201
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048072_949048083 1 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048076_949048083 -9 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data
949048077_949048083 -10 Left 949048077 2:241881428-241881450 CCACCTGGACCCCACACTGGGTC No data
Right 949048083 2:241881441-241881463 ACACTGGGTCAGCCCTGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048083 Original CRISPR ACACTGGGTCAGCCCTGGTG CGG Intergenic