ID: 949048086

View in Genome Browser
Species Human (GRCh38)
Location 2:241881453-241881475
Sequence CAGCGGCCTCCTCCGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048086_949048100 18 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048100 2:241881494-241881516 CACGCGTTAAGGGGCTGGACGGG No data
949048086_949048097 9 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048097 2:241881485-241881507 ACGGGGCAGCACGCGTTAAGGGG No data
949048086_949048099 17 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048099 2:241881493-241881515 GCACGCGTTAAGGGGCTGGACGG No data
949048086_949048104 24 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048104 2:241881500-241881522 TTAAGGGGCTGGACGGGGGGTGG No data
949048086_949048102 20 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048102 2:241881496-241881518 CGCGTTAAGGGGCTGGACGGGGG No data
949048086_949048103 21 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048103 2:241881497-241881519 GCGTTAAGGGGCTGGACGGGGGG No data
949048086_949048101 19 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048101 2:241881495-241881517 ACGCGTTAAGGGGCTGGACGGGG No data
949048086_949048096 8 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048096 2:241881484-241881506 CACGGGGCAGCACGCGTTAAGGG No data
949048086_949048092 -9 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048092 2:241881467-241881489 AGGCCGCTGTAGGTGGGCACGGG No data
949048086_949048091 -10 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048091 2:241881466-241881488 GAGGCCGCTGTAGGTGGGCACGG No data
949048086_949048095 7 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048095 2:241881483-241881505 GCACGGGGCAGCACGCGTTAAGG No data
949048086_949048098 13 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048098 2:241881489-241881511 GGCAGCACGCGTTAAGGGGCTGG No data
949048086_949048093 -8 Left 949048086 2:241881453-241881475 CCCTGGTGCGGAGGAGGCCGCTG No data
Right 949048093 2:241881468-241881490 GGCCGCTGTAGGTGGGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048086 Original CRISPR CAGCGGCCTCCTCCGCACCA GGG (reversed) Intergenic