ID: 949048088

View in Genome Browser
Species Human (GRCh38)
Location 2:241881457-241881479
Sequence GGTGCGGAGGAGGCCGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949048070_949048088 24 Left 949048070 2:241881410-241881432 CCGGGGGCCTACCAGAGCCCACC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048073_949048088 13 Left 949048073 2:241881421-241881443 CCAGAGCCCACCTGGACCCCACA No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048069_949048088 25 Left 949048069 2:241881409-241881431 CCCGGGGGCCTACCAGAGCCCAC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048076_949048088 7 Left 949048076 2:241881427-241881449 CCCACCTGGACCCCACACTGGGT No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048082_949048088 -5 Left 949048082 2:241881439-241881461 CCACACTGGGTCAGCCCTGGTGC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048078_949048088 3 Left 949048078 2:241881431-241881453 CCTGGACCCCACACTGGGTCAGC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048072_949048088 17 Left 949048072 2:241881417-241881439 CCTACCAGAGCCCACCTGGACCC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048080_949048088 -3 Left 949048080 2:241881437-241881459 CCCCACACTGGGTCAGCCCTGGT No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048081_949048088 -4 Left 949048081 2:241881438-241881460 CCCACACTGGGTCAGCCCTGGTG No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data
949048077_949048088 6 Left 949048077 2:241881428-241881450 CCACCTGGACCCCACACTGGGTC No data
Right 949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949048088 Original CRISPR GGTGCGGAGGAGGCCGCTGT AGG Intergenic
No off target data available for this crispr